B R I E F C OMMUN I C A T I O N
Fast and cost-efficient species identification of Atlantic salmon
(Salmo salar L.), brown trout (Salmo trutta), and their hybrids
using a single SNP marker
Tutku Aykanat1 | Athina Balatsou1 | Kirsi Kähkönen1 | Jukka T. Syrjänen2,3 |
Matti Janhunen4 | Tuomas Leinonen5 | Jenni M. Prokkola6 |
Johnny R. Norrgård7 | John J. Piccolo8
1Organismal and Evolutionary Biology Research Program, Faculty of Biological and Environmental Sciences, University of Helsinki, Helsinki, Finland
2Department of Biological and Environmental Science, University of Jyväskylä, Jyväskylä, Finland
3Kala- ja vesistötutkimus Vesi-Visio, Jyväskylä, Finland
4Natural Resources Institute Finland (LUKE), Joensuu, Finland
5Natural Resources Institute Finland (LUKE), Helsinki, Finland
6Natural Resources Institute Finland (LUKE), Oulu, Finland
7Gammelkroppa Lax AB, Filipstad, Sweden
8River Ecology and Management Group, Karlstad University, Karlstad, Sweden
Correspondence
Tutku Aykanat, Organismal and Evolutionary
Biology Research Program, Faculty of
Biological and Environmental Sciences,
University of Helsinki, Finland.
Email: tutku.aykanat@helsinki.fi
Funding information
the Research Council of Finland, Grant/Award
Numbers: 325964, 348965, 347368; R.Erik
and Bror Serlachius Foundation; Swedish
Centre for Sustainable Hydropower,
Grant/Award Number: VKU31016; the Centre
for Economic Development, Transport and the
Environment; Fortum Sverige AB
Abstract
A workflow for developing a cost- and time-efficient, single nucleotide polymorphism
(SNP)-based assay for species and hybrid identification is described. In a reference
set (n = 46), the developed assay identified individuals of two closely related species,
the Atlantic salmon (Salmo salar L., n = 23) and brown trout (Salmo trutta, n = 23),
with 100% accuracy. Furthermore, species and hybrid identification using field-
collected embryos had 98.1% concordance (155/158) to more expensive and
time-consuming methods that utilized multiple SNP markers. The method can be inte-
grated into management and conservation plans to quantify species' spawning distri-
bution and hybridization rates.
K E YWORD S
conservation genetics, diagnostic locus, hybridization, KASP SNP-assays, species identification
Accurate species identification is a cornerstone of conservation biol-
ogy, but distinguishing even well-known species can be challenging.
As an example, two closely related salmonid species with overlapping
distributions and habitats, Atlantic salmon (Salmo salar) and brown
trout (Salmo trutta), or cutthroat trout (Oncorhynchus clarki) and rain-
bow trout (Oncorhynchus mykiss), are difficult to differentiate visually
in early life stages (Allendorf et al., 2001; Makhrov, 2008). Further,
the occurrence of hybrids between these species pairs makes accu-
rate identification even more difficult. Hybridization may reduce par-
ents' fitness via reduced reproductive success (with conspecifics), and
decrease population viability and productivity due to introgression
(Allendorf et al., 2001; Garcia-Vazquez et al., 2004; Makhrov, 2008;
Received: 18 July 2024 Revised: 29 November 2024 Accepted: 1 December 2024
DOI: 10.1111/jfb.16032
FISH
This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any
medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
© 2024 The Author(s). Journal of Fish Biology published by John Wiley & Sons Ltd on behalf of Fisheries Society of the British Isles.
J Fish Biol. 2024;1–5. wileyonlinelibrary.com/journal/jfb 1
McKelvey et al., 2016). Thus, hybridization may have important eco-
evolutionary consequences for species with low pre- or post-zygotic
barriers, and represents a major conservation challenge, particularly in
small populations (Allendorf et al., 2001).
The hybrids of Atlantic salmon and brown trout are functionally
sterile either in the first or second generation (Galbreath &
Thorgaard, 1995; Makhrov, 2008). The anthropogenic drivers of river
regulation (e.g., changes in downstream water regime as a result of
dam constructions, and subsequent water flow regulations) and
spawning habitat limitations, combined with a typically limited number
of spawners (i.e., shortage of potential mates), may increase the
hybridization rates between salmon and trout populations, thus
emphasizing the need for continued monitoring (Allendorf
et al., 2001). Existing visual identification methods for salmon-trout
hybrids require expertise and may not always be accurate
(Makhrov, 2008; Koljonen & Koskiniemi, 2020). For example, despite
brown trout embryos being typically larger due to earlier spawning
periods than Atlantic salmon, size distributions at early life stages
overlap considerably (Heggberget et al., 1988). While genetically
based species and hybrid detection methods provide a powerful alter-
native, the current single-marker method to identify Atlantic salmon
and brown trout is based on detecting a species-specific length poly-
morphism in a microsatellite marker (12 bp difference between two
species), which requires a cost- and time-consuming fragment analysis
step (Perrier et al., 2010).
Assays targeting differences in single nucleotide polymorphism
such as the PCR-based Kompetitive Allele-Specific PCR (KASP,
Semagn et al., 2013) are fast and cost-efficient methods that have
been widely used in ecological and evolutionary research
(Wenne, 2023). In salmonids, such a method has been applied to
detect single gene polymorphisms within controlled crosses (Prokkola
et al., 2022). These methods are also suitable for identifying two
closely related species, that is, by exploiting fixed single-nucleotide
differences between species (e.g., Devran & Göknur, 2020; Çatalkaya
et al., 2023).
In this study, we describe a workflow to develop and validate a
SNP-based KASP assay for species and hybrid identification using
a dataset from endemic landlocked Atlantic salmon and brown trout
populations in the River Gullspång, Sweden as the case system (data-
set1). The assay was further verified using another dataset (dataset2),
from the River Pielisjoki (Laurinvirta stream), Finland, which is the
original spawning area of the critically endangered Lake Saimaa
salmon and of the highly endangered migratory population of brown
trout. Dataset1 was composed of a reference set that consists of
23 Atlantic salmon spawners and 23 brown trout juveniles reared in a
conservation fish hatchery, and a test set that consists of 65 fertilized
eggs (eyed embryos) sampled in the field from salmon/trout redds
(Supporting Information Data S1). Gullspång in February 2023. Data-
set2 was composed of 94 fertilized eggs (eyed embryos) sampled in
the field from salmon/trout redds in 2022 and 2023.
Species and hybrid identification using multi-SNP assays: We first con-
ducted species and hybrid identification analysis using multi-SNP
genetic markers. Samples from dataset1 were genotyped with
146 SNP markers initially designed for Atlantic salmon (Aykanat
et al., 2016) using the genotyping-by-sequencing approach (described
in Aykanat et al., 2020), and dataset2 was initially genotyped for 4457
SNP markers using DNA TRACEBACK® Fisheries SNP genotyping
array FSHSTK1D (IdentiGEN Limited, Dublin, Ireland), designed for
genotyping seven fish species (MultiFishSNPChip_1.0 array;
Andersson et al., 2024).
For dataset1, we employed coverage-based species identification
methods, in which mean SNP coverage for Atlantic salmon-specific
SNP markers (SNP markers that did not amplify in brown trout,
n = 15) standardized to the mean coverage of interspecific SNP
markers (SNP markers that amplified equally well in both species,
N = 74) were used as a criteria to identify species and their hybrids
(Figure S1a and Supporting Information Data S1). Out of 63 embryo
samples, 18, 33, and 12 were assigned as Atlantic salmon, brown
trout, and hybrids, respectively (Table 1 and Figure 1a). For dataset2,
principal component analysis (PCA) was performed using dudi.pca
function in the ade4 package (version 1.7–22, Dray & Dufour, 2007)
in R version 4.4.1 (R Core Team 2024), which separated species and
hybrid groups into three clusters. Out of 94 embryo samples, 60, 24,
10 were assigned as Atlantic salmon, brown trout, and hybrids,
respectively (Table 1 and Figure 1b).
Designig the KASP assay and genotyping: SNP markers amplified in
Atlantic salmon but not in brown trout were candidates for designing
a species-specific KASP assay (Figure S1a and Supporting Information
Data S1). Approximately 100 bp DNA sequence around one of these
Atlantic salmon specific markers was aligned to the brown trout
(Genome assembly fSalTru1.1) and Atlantic salmon genomes (Genome
assembly Ssal_v3.1) using the NCBI BLAST tool, and nucleotide
TABLE 1 Species identification and concordance.
Sample
Assigned using multi-SNP panel (AS/BT/
hybrid/NA)
Assigned using KASP assay (AS/BT/
hybrid/NA)
Concordance between
methods
Atlantic salmon 23/0/0/0 23/0/0/0 100%
Brown trout 0/0/23/0 0/0/23/0 100%
Embryos
(dataset1)
18/33/12/0 19/34/10/0 96.8%
Embryos
(dataset2)
60/24/10/0 59/24/10/1 98.9%
Abbreviations: AS, Atlantic salmon; BT, brown trout; NA, unidentified individuals.
2 AYKANAT ET AL.FISH
 10958649, 0, D
ow
nloaded from
 https://onlinelibrary.w
iley.com
/doi/10.1111/jfb.16032 by Luonnonvarakeskus, W
iley Online Library on [19/12/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on W
iley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
0 20 40 60 80 100
0.
0
0.
5
1.
0
1.
5
−40 −20 0 20 40 60 80
−3
0
−2
0
−1
0
0
10
Principal component 1
Pr
in
ci
pa
l c
om
po
ne
nt
 2
2800 3000 3200 3400 3600 3800
26
00
28
00
30
00
32
00
34
00
2800 3000 3200 3400 3600 3800
26
00
28
00
30
00
32
00
34
00
Atlantic salmon specific amplification (RFUFAM)
Br
ow
n 
tro
ut
 s
pe
ci
fic
 a
m
pl
ifi
ca
tio
n 
(R
FU
HE
X)
St
an
da
rd
iz
ed
 S
N
P 
co
ve
ra
ge
  (
N
SN
P =
 8
9)
Individual index
(a) (b)
(c) (d)
Reference set Test set
Brown trout
pure-type
Brown trout
pure-type
Atlantic salmon
pure-type Atlantic salmonpure-type
Hybrids
Hybrids
dataset1 dataset2
dataset2dataset1
Species and hybrid identification with one SNP KASP assay 
Species and hybrid identification with multi-SNP assays
F IGURE 1 Accuracy and concordance of species and hybrid identification across multi-SNP and one-SNP KASP assays. (a) Species identification
using standardized coverage of individuals using the genotyping-by-sequencing method in dataset1. The reference set is indicated with filled black
and red points for Atlantic salmon and brown trout, respectively. Black, red, and blue circles are embryos in the test set identified as Atlantic salmon,
brown trout, and hybrids, respectively. The solid black line is four standard deviations below the average standardized coverage (dashed black line)
obtained from the Atlantic salmon reference set and is used as the cut-off value for pure-type Atlantic salmon identification. The solid red line is the
cut-off value for pure-type brown trout identification. Samples located in between the two solid lines are identified as hybrids. Circled samples
indicate mismatches to KASP identification. (b) Species identification using principal component analysis using 4457 SNP markers in dataset1. Black,
red, and blue circles are individuals in the test set identified as Atlantic salmon, brown trout, and hybrids, respectively. (c, d) Species identification
using one SNP marker KASP assay (TN_1579_SNP_M). The x and y axes indicate Atlantic salmon- and brown trout-specific fluorescence intensities,
respectively. Filled black and red circles in (c) are Atlantic salmon and brown trout individuals in the reference set, respectively. Black, red, and blue
empty circles indicate embryos in each test set identified as Atlantic salmon, brown trout, and hybrids, respectively, using the multi-SNP dataset. The
grey areas are three visual clusters representing the pure-type species and the hybrids.
AYKANAT ET AL. 3FISH
 10958649, 0, D
ow
nloaded from
 https://onlinelibrary.w
iley.com
/doi/10.1111/jfb.16032 by Luonnonvarakeskus, W
iley Online Library on [19/12/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on W
iley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
differences between the two species were identified. Primers were
then designed by LGC genomics (UK) for a KASP assay (named as
TN_1579_SNP_M), whereby the species-specific nucleotide polymor-
phism is located in chromosome 30 at position 41097526 in brown
trout, and in chromosome 13 at position 8608040 in Atlantic salmon.
A common reverse primer was designed to perfectly align with both
species' DNA (50 GTTAGAAACACATCCACACCCRAAACAT 30), while
two forward primers were designed with a species-specific nucleotide
at the 30 end of the primers (Atlantic salmon specific forward primer:
50 CAGGGTGGATTTGGTGGAAGTA 30 and brown trout specific for-
ward: 50 CAGGGTGGATTTGGTGGAAGTC 30; Figure S1b). These
forward primers were fluorescently labelled with FAM and HEX dyes,
respectively, to generate species-specific optical signals.
Using dataset1 and dataset2, the PCR reaction for the assay was
performed in a 384-well plate in 4 μL (2 μL of KASP 2 Mastermix
and 0.05 μL of primer mix, supplied by LGC Genomics, UK), and 2 μL
of 1/20 diluted genomic DNA. The reactions were conducted using a
quantitative PCR (qPCR) machine (C1000 Thermal cycler with
CFX384 Real-Time System; Bio-Rad) under the following thermal
cycling conditions: an initial denaturation step at 94C for 15 min,
10 cycles each consisting of a denaturation at 94C for 20 s and
annealing/extension at 61C for 1 min (decreasing temperature by
0.6C/cycle), 35 cycles of denaturation at 94C for 20 s and anneal-
ing/extension at 55C for 1 min. Fluorescence signal analysis for alle-
lic discrimination was performed using the CFX Maestro software
(Bio-Rad).
The KASP assay clearly identified brown trout and Atlantic salmon
reference sets as two distinct clusters (Figure 1c,d). The genetic assign-
ment of the test subjects was also in concordance with the results
obtained with the SNP set, with 98.5% (62/64) and 99.0% (93/94)
accuracy between the two methods for dataset1 and
dataset2, respectively (Figure 1c,d and Table 1). In dataset1, two indi-
viduals identified as Atlantic salmon and brown trout using the multi-
SNP analysis were identified as hybrids in the KASP assays
(Figure 1b,d). In dataset2, one individual identified as Atlantic salmon
was unidentified in the KASP assays (Figure 1d). In general, species and
hybrid specific clusters were remarkably distinct in the KASP assay.
The assay is expected to be highly reliable for species identifica-
tion and to quantify hybridization across the overlapping range of
these species, since the SNP sequences that we designed primers for
were retrieved from the reference genomes of Atlantic salmon and
brown trout obtained from individuals from large geographical areas,
and verified in two independent systems.
The KASP assay is a very cost-effective method for species iden-
tification. Given the institution has appropriate equipment, such as a
384-well plate optical thermocycler, the cost of sequencing, including
primers and master mix, and a 384-well optical plate, are 49.17€ per
plate (i.e., 384 samples), which is 0.13€ per sample, not including the
costs of DNA extraction and personnel. (Costs will be likely higher for
the 96-well plate since higher reaction volumes are generally
required.) While we used a high-quality DNA extraction method,
KASP assays are robust to more economical alternatives such as salt
extraction and commercial quick extraction methods such as Lucigen
QuickExtract kits (e.g., Prokkola et al., 2022). Likewise, preparing the
assays requires only setting up the PCR reactions, which can be com-
pleted in a few hours, reducing personal costs and turnaround times.
The use of a pipetting robot for dispensing reagents on plates can
further reduce the working time needed, but it is not required for run-
ning the assay.
In conclusion, we demonstrated a workflow for designing and val-
idating a single SNP marker-based species and hybrid identification
assay. The designed assay confidently identified two closely related
salmonid species, the Atlantic salmon and brown trout, and their
reciprocal hybrids quickly and cost-efficiently compared to the
methods that rely on detecting length polymorphisms (e.g., Perrier
et al., 2010). The assay is especially suitable for identifying samples
collected in the field during early development (embryos, newly-
hatched alevins and parr), but also at later life stages, and for monitor-
ing the relative rates of hybridization between species. Integrating the
developed species identification methods to redd counting (Syrjänen
et al., 2014) and embryo sampling provides a robust methodology to
estimate the sizes of spawning stocks of sympatric stream-spawning
salmonids, which, for example, can be beneficial for more efficient
conservation of endangered salmon and trout stocks. Lowering the
cost and decreasing the turnaround times of analysis are important
factors in expanding this set of methods in the management and mon-
itoring of sympatric, especially endangered, salmonid stocks, and in
improving and verifying channel restoration methods (e.g. Piccolo
et al., 2012). The workflow can also be used to discover multiple
species-specific SNPs, which can be used to study the viability and
fertility of second-generation hybrids in the wild. Furthermore, when
used in combination with mitochondrial assays (e.g., Karlsson
et al., 2012), one can also infer the parental origin of hybrid
individuals.
Monitoring the coexistence and demogenetics of sympatric sal-
monid species pairs can have far-reaching consequences for conserva-
tion. In particular, for our case study in River Gullspång (dataset1), we
found a remarkably high number of hybrids from the embryo samples
from the field, indicating a significant level of hybridization for the
populations with potential fitness consequences. On a broader scale,
anthropogenic drivers, such as river regulation and climate change,
may break down historic temporal or spatial ecological barriers
between co-evolved sympatric salmonid species, allowing for an
increased rate of hybridization (Garcia-Vazquez et al., 2003) and in
some cases the loss of species integrity (McKelvey et al., 2016). Our
workflow can be easily implemented with other studies that aim to
identify species of interest and their potential hybrids.
AUTHOR CONTRIBUTIONS
Concept: T.A., J.M.P., J.N., and J.J.P. Sample collection: J.T.S., M.J.,
J.N., and J.J.P. Laboratory work and analyses: T.A., A.B., K.K., and
T.L. Writing: T.A., J.T.S., M.J., J.M.P., and J.J.P.
ACKNOWLEDGEMENTS
We thank the University of Helsinki DNA Sequencing and Genomics
laboratory for performing the genotyping-by-sequencing, LGC
4 AYKANAT ET AL.FISH
 10958649, 0, D
ow
nloaded from
 https://onlinelibrary.w
iley.com
/doi/10.1111/jfb.16032 by Luonnonvarakeskus, W
iley Online Library on [19/12/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on W
iley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
genomics (UK) and Steve Smith from LGC genomics for helps in the
assay design, and Iikki Donner and Craig Primmer for providing us
with the primer pool for the genotyping-by-sequencing assays. We
also thank the anonymous reviewer for constructive suggestions.
FUNDING INFORMATION
This study was funded by the Fortum Sverige AB (to J.T.S. and T.A.),
the R. Erik and Bror Serlachius Foundation (to J.T.S.), the Centre for
Economic Development, Transport and the Environment (fisheries
funds of ELY Centre of North Savo; to M.J.), the Swedish Center for
Sustainable Hydropower Project VKU31016 (to J.J.P.), and the
Research Council of Finland (325964 to T.A., 348965 to J.M.P.,
347368 to T.L.).
DATA AVAILABILITY STATEMENT
The compiled datasets and R-codes to reproduce the results are avail-
able from the figshare repository at https://doi.org/10.6084/m9.
figshare.27679287.
ORCID
Tutku Aykanat https://orcid.org/0000-0002-4825-0231
REFERENCES
Allendorf, F. W., Leary, R. F., Spruell, P., & Wenburg, J. K. (2001). The prob-
lems with hybrids: Setting conservation guidelines. Trends in Ecology
and Evolution, 16, 613–622.
Andersson, L., Bekkevold, D., Berg, F., Farrell, E. D., Felkel, S.,
Ferreira, M. S., Fuentes-Pardo, A. P., Goodall, J., & Pettersson, M.
(2024). How fish population genomics can promote sustainable fisher-
ies: A road map. Annual Review of Animal Biosciences, 12(1), 1–20.
Aykanat, T., Lindqvist, M., Pritchard, V. L., & Primmer, C. R. (2016). From
population genomics to conservation and management: A workflow
for targeted analysis of markers identified using genome-wide
approaches in Atlantic salmon Salmo salar. Journal of Fish Biology, 89,
2658–2679.
Aykanat, T., Rasmussen, M., Ozerov, M., Niemela, E., Paulin, L., Vaha, J. P.,
Hindar, K., Wennevik, V., Pedersen, T., Svenning, M. A., &
Primmer, C. R. (2020). Life-history genomic regions explain differences
in Atlantic salmon marine diet specialization. Journal of Animal Ecology,
89, 2677–2691.
Çatalkaya, M., Göknur, A., & Devran, Z. (2023). Development of SNP-
based assays for identification of Globodera rostochiensis and Globo-
dera pallida. Journal of Plant Diseases and Protection, 130, 1041–1048.
Devran, Z., & Göknur, A. (2020). Development and validation of a SNP-
based KASP assay for rapid identification of Aphelenchoides besseyi
Christie, 1942. Crop Protection, 6, 105235.
Dray, S., & Dufour, A.-B. (2007). The ade4 package: Implementing the
duality diagram for ecologists. Journal of Statistical Software, 22, 1–20.
Galbreath, P. F., & Thorgaard, G. H. (1995). Sexual maturation and fertility
of diploid and triploid Atlantic salmon X brown trout hybrids. Aquacul-
ture, 137, 299–311.
Garcia-Vazquez, E., Ayllon, F., Martinez, J. L., Perez, J., & Beall, E. (2003).
Reproduction of interspecific hybrids of Atlantic salmon and brown
trout in a stream environment. Freshwater Biology, 48, 1100–1104.
Garcia-Vazquez, E., Perez, J., Ayllon, F., Martinez, J. L., Glise, S., & Beall, E.
(2004). Asymmetry of post-F1 interspecific reproductive barriers
among brown trout (Salmo trutta) and Atlantic salmon (Salmo salar).
Aquaculture, 234, 77–84.
Heggberget, T. G., Haukebø, T., Mork, J., & Ståhl, G. (1988). Temporal and
spatial segregation of spawning in sympatric populations of Atlantic
salmon, Salmo salar L., and brown trout, Salmo trutta L. Journal of Fish
Biology, 33, 347–356.
Karlsson, S., Hagen, M., Eriksen, L., Hindar, K., Jensen, A. J., de
Leaniz, C. G., Cotter, D., Guðbergsson, G., Kahilainen, K.,
Guðjónsson, S., Romakkaniemi, A., & Ryman, N. (2012). A genetic
marker for the maternal identification of Atlantic salmon  brown
trout hybrids. Conservation Genetics Resources, 5, 47–49.
Koljonen, M.-L., & Koskiniemi, J. (2020). Genetic structure of Swedish
River Gullspångsälven lake salmon and brown trout. Natural Resources
Institute Finland (Luke) 77/2022. Permanent url: http://urn.fi/URN:
ISBN:978-952-380-508-8
Makhrov, A. A. (2008). Hybridization of the Atlantic salmon (Salmo salar L.)
and brown trout (S. Trutta L.). Zoosystematica Rossica, 17, 129–143.
McKelvey, K. S., Young, M. K., Wilcox, T. M., Bingham, D. M.,
Pilgrim, K. L., & Schwartz, M. K. (2016). Patterns of hybridization
among cutthroat trout and rainbow trout in northern Rocky Mountain
streams. Ecology and Evolution, 6, 688–706.
Perrier, C., Grandjean, F., Le Gentil, J., Cherbonnel, C., & Evanno, G.
(2010). A species-specific microsatellite marker to discriminate
European Atlantic salmon, brown trout, and their hybrids. Conservation
Genetics Resources, 3, 131–133.
Piccolo, J. J., Norrgård, J. R., Greenberg, L. A., Schmitz, M., & Bergman, E.
(2012). Conservation of endemic landlocked salmonids in regulated
rivers: A case-study from Lake Vänern, Sweden. Fish and Fisheries, 13,
418–433.
Prokkola, J. M., Asheim, E. R., Morozov, S., Bangura, P., Erkinaro, J.,
Ruokolainen, A., Primmer, C. R., & Aykanat, T. (2022). Genetic coupling
of life-history and aerobic performance in Atlantic salmon. Proceedings
of the Royal Society B: Biological Sciences, 289, 20212500.
R Core Team. (2024). R: A language and environment for statistical comput-
ing. R Foundation for Statistical Computing. Permanent url: https://
www.R-project.org/
Semagn, K., Babu, R., Hearne, S., & Olsen, M. (2013). Single nucleotide
polymorphism genotyping using Kompetitive allele specific PCR
(KASP): Overview of the technology and its application in crop
improvement. Molecular Breeding, 33, 1–14.
Syrjänen, J. T., Sivonen, K., & Sivonen, O. (2014). Redd counting in moni-
toring salmonids in Finnish inland waters. In R. F. Carline & C. LoSapio
(Eds.), Wild trout XI: Looking back and moving forward (pp. 288–294).
Wild Trout Symposium.
Wenne, R. (2023). Single nucleotide polymorphism markers with applica-
tions in conservation and exploitation of aquatic natural populations.
Animals (Basel), 13, 1089.
SUPPORTING INFORMATION
Additional supporting information can be found online in the Support-
ing Information section at the end of this article.
How to cite this article: Aykanat, T., Balatsou, A., Kähkönen,
K., Syrjänen, J. T., Janhunen, M., Leinonen, T., Prokkola, J. M.,
Norrgård, J. R., & Piccolo, J. J. (2024). Fast and cost-efficient
species identification of Atlantic salmon (Salmo salar L.), brown
trout (Salmo trutta), and their hybrids using a single SNP
marker. Journal of Fish Biology, 1–5. https://doi.org/10.1111/
jfb.16032
AYKANAT ET AL. 5FISH
 10958649, 0, D
ow
nloaded from
 https://onlinelibrary.w
iley.com
/doi/10.1111/jfb.16032 by Luonnonvarakeskus, W
iley Online Library on [19/12/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on W
iley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License