Jukuri, open repository of the Natural Resources Institute Finland (Luke) All material supplied via Jukuri is protected by copyright and other intellectual property rights. Duplication or sale, in electronic or print form, of any part of the repository collections is prohibited. Making electronic or print copies of the material is permitted only for your own personal use or for educational purposes. For other purposes, this article may be used in accordance with the publisher’s terms. There may be differences between this version and the publisher’s version. You are advised to cite the publisher’s version. This is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail. Author(s): Meng Wang, Louis J. Lamit, Erik A. Lilleskov, Nathan Basiliko, Tim R. Moore, Jill L. Bubier, Galen Guo, Sari Juutinen, Tuula Larmola Title: Peatland Fungal Community Responses to Nutrient Enrichment: A Story Beyond Nitrogen Year: 2024 Version: Final draft Copyright: The Author(s) 2024 Rights: This Item is protected by copyright and/or related rights. You are free to use this Item in any way that is permitted by the copyright and related rights legislation that applies to your use. For other uses you need to obtain permission from the rights- holder(s) Rights url: https://rightsstatements.org/page/InC/1.0/?language=en Please cite the original version: Wang, M., Lamit, L., Lilleskov, E., Basiliko, N., Moore, T., Bubier, J., Guo, G., Juutinen, S. and Larmola, T. (2024), Peatland Fungal Community Responses to Nutrient Enrichment: A Story Beyond Nitrogen. Glob Change Biol, 30: e17562. https://doi.org/10.1111/gcb.17562 https://rightsstatements.org/page/InC/1.0/?language=en https://doi.org/10.1111/gcb.17562 1 1 Title: Peatland fungal community responses to nutrient enrichment: a 2 story beyond nitrogen 3 4 Running title: N and PK additions changed fungal community 5 6 Meng Wang1,2*, Louis J. Lamit3, Erik A. Lilleskov4, Nathan Basiliko5,6, Tim 7 Moore7, Jill Bubier8, Galen Guo6,9, Sari Juutinen10, Tuula Larmola11 8 9 1Key Laboratory of Geographical Processes and Ecological Security in 10 Changbai Mountains, Ministry of Education, School of Geographical Sciences, 11 Northeast Normal University, Changchun, Jilin, China 12 2State Environmental Protection Key Laboratory of Wetland Ecology and 13 Vegetation Restoration, Institute for Peat and Mire Research, Northeast 14 Normal University, Changchun, Jilin, China 15 3Department of Biology, Syracuse University, Syracuse, New York, USA. 16 4USDA Forest Service, Northern Research Station, Houghton, Michigan, USA 17 5Faculty of Natural Resources Management, Lakehead University, Thunder 18 Bay, Ontario Canada 19 6Vale Living with Lakes Centre, Laurentian University, Sudbury, Ontario 20 Canada 21 7Department of Geography, McGill University, Montreal, Quebec, Canada 22 8Department of Environmental Studies, Mount Holyoke College, South 23 Hadley, Massachusetts, USA 24 9School of Pharmaceutical Sciences, University of Ottawa, Ottawa, Ontario, 25 Canada 26 10Finnish Meteorological Institute, Climate System Research, Helsinki, Finland 27 11Natural Resources Institute Finland (Luke), Helsinki, Finland 28 29 *Correspondence: meng.wang3@mail.mcgill.ca; Tel. +86-431-85099550 Page 1 of 51 Global Change Biology mailto:meng.wang3@mail.mcgill.ca 2 30 ORCiD: 31 Meng Wang: 0000-0001-5291-5622 32 Louis J. Lamit: 0000-0002-0385-6010 33 Erik A. Lilleskov: 0000-0002-9208-1631 34 Nathan Basiliko: 0000-0001-8512-9484 35 Tim Moore: 0000-0001-7472-7569 36 Jill Bubier: 0000-0002-3282-3015 37 Galen Guo: 0000-0003-3651-1403 38 Sari Juutinen: 0000-0002-7752-1950 39 Tuula Larmola: 0000-0002-9350-6689 40 Page 2 of 51Global Change Biology 3 41 Abstract 42 Anthropogenically elevated inputs of nitrogen (N), phosphorus (P) and 43 potassium (K) can affect the carbon (C) budget of nutrient-poor peatlands. 44 Fungi are intimately tied to peatland C budgets due to their roles in organic 45 matter decomposition and symbioses with primary producers; however the 46 influence of fertilization on peatland fungal composition and diversity remains 47 unclear. Here we examined the effect of fertilization over 10-yrs on fungal 48 diversity, composition, and functional guilds along an acrotelm (10-20 cm), 49 mesotelm (30-40 cm) and catotelm (60-70 cm) depth gradient at the Mer 50 Bleue bog, Canada. Simultaneous N and PK addition decreased the relative 51 abundance of ericoid mycorrhizal fungi (ErMF) and increased ectomycorrhizal 52 fungi (EcMF) and lignocellulose-degrading fungi. Fertilization effects were not 53 more pronounced in the acrotelm relative to the catotelm, nor was there a shift 54 towards nitrophilic taxa after N addition. The direct effect of fertilization 55 significantly decreased the abundance of Sphagnum-associated fungi, 56 primarily owing to the overarching role of limiting nutrients rather than a 57 decline in Sphagnum cover. Increased nutrient loading may threaten peatland 58 C stocks if lignocellulose-degrading fungi become abundant and accelerate 59 decomposition of recalcitrant organic matter. Additionally, future changes in 60 plant communities, strong water table fluctuations, and peat subsidence after 61 long-term nutrient loading may also influence fungal functional guilds and 62 depth-dependencies of fungal community structure. 63 64 KEYWORDS: co-limitation; fertilization; fungal guilds; stratification; 65 vegetation; peatland 66 Page 3 of 51 Global Change Biology 4 67 1 | INTRODUCTION 68 Anthropogenic activities have increased the availability, and altered the 69 stoichiometry, of nutrients such as nitrogen (N) and phosphorus (P) in 70 nutrient-limited ecosystems (Peñuelas et al., 2013; Wang et al., 2017). The 71 imbalance in global atmospheric inorganic N and P deposition has resulted in 72 a lower N:P ratio in deposition and alteration to ecosystem processes in N 73 and P deficient ecosystems (Ackerman et al., 2019; Du et al., 2020; Peñuelas 74 et al., 2013; Wang et al., 2017). N enrichment may also be increasing 75 potassium (K) limitation (Hoosbeek et al., 2002). However, there is a dearth of 76 knowledge regarding the direct and indirect long-term effects of N and P 77 enrichment on peatland soil microorganisms (Li et al., 2021). 78 Peatlands are one of the largest global soil carbon (C) reservoirs (Loisel 79 et al., 2014). Acidic Sphagnum peatlands (bogs and poor fens) are 80 widespread in northern latitudes and have low nutrient availabilities owing to 81 slow rates of organic matter decomposition, hydrologic isolation, and limited 82 atmospheric nutrient input under non-anthropogenically altered conditions 83 (Charman, 2002; Rydin & Jeglum, 2013). Research has largely focused on 84 the detrimental effects of elevated N deposition on peatlands (Bragazza et al., 85 2012; Sheppard et al., 2014), with less focus on P, despite its integral role in 86 peatland biogeochemistry (Bubier et al., 2007; Fritz et al., 2012; Schillereff et 87 al., 2021). In ombrotrophic (precipitation-fed) peatlands (i.e., bogs), plant 88 growth and microbial activities are often limited by P or co-limited by N and P 89 as they receive nutrients exclusively from atmospheric deposition (Bridgham 90 et al., 1996; Hill et al., 2014; Lin et al., 2014a; Wang et al., 2016) or N fixation 91 (Yin et al., 2022; Živković et al., 2022). For example, at Mer Bleue bog in 92 southeastern Canada, the combined addition of N, P and K showed a more 93 profound effect on shrub biomass production and litter decomposition than N- 94 only fertilization after 7 to 12-yrs of treatment (Larmola et al., 2013; Moore et 95 al., 2019). Page 4 of 51Global Change Biology 5 96 Changes in plant community composition arising from nutrient addition 97 can also have long-term consequences for peatland C cycling. Although 98 Sphagnum mosses have long been hypothesized to constrain peat 99 decomposition (Bengtsson et al., 2018; Pipes & Yavitt, 2022; van Breemen, 100 1995), recent studies have demonstrated that the large quantity of 101 polyphenolics in vascular litters could also be an important constraint on peat 102 decomposition (Fenner & Freeman, 2020). Shifts from dominance by 103 Sphagnum mosses to vascular plants (especially evergreen shrubs), may 104 change litter quality, slowing decomposition rates and leading to C 105 accumulation in peatlands (Fenner & Freeman, 2020; Li et al., 2021; Wang et 106 al., 2015). Additionally, ectomycorrhizal trees and ericaceous shrubs differ in 107 mycorrhizal symbionts, with possible consequences for alteration of 108 decomposition dynamics that could affect a peatland’s ability to sequester C 109 (Defrenne et al., 2023; Hupperts et al., 2022). 110 Our current understanding of the effect of nutrient deposition on peatland 111 fungal communities remains fragmentary (Andersen et al., 2013). Cao et al. 112 (2022) found that long-term N and P additions had stronger effects on fungal 113 community compared to short-term additions. Short-term increased N 114 deposition has been observed to favor bacterial growth owing to the changes 115 in peat chemistry (Bragazza et al., 2012), whereas the simultaneous addition 116 of N, P and K increased fungal biomass (Basiliko et al., 2006). Long-term 117 nutrient deposition may exert cascading effects on microbial community 118 composition and diversity via the changes in vegetation composition and 119 cover. For example, the encroachment of shrubs at the expense of Sphagnum 120 moss after long-term N deposition (Larmola et al., 2013; Li et al., 2019) was 121 detrimental to fungi associated with Sphagna via endophytic or symbiotic 122 relationships (i.e., Sphagnum-associated fungi) but advantageous to fungi 123 associated with ericaceous shrubs and trees, especially mycorrhizal fungi 124 (Andersen et al., 2013). Within functional guilds, communities may shift as a Page 5 of 51 Global Change Biology 6 125 response to nutrient addition. For example, ectomycorrhizal fungal (EcMF) 126 species have been found to differ greatly in their response to N fertilization in 127 uplands, with a decline in so-called nitrophobic fungi and an increase in 128 nitrophilic fungi (Lilleskov et al., 2011, 2024). However, there have not been 129 studies exploring whether this pattern holds in peatlands. 130 N fertilization has been hypothesized to shift fungal communities away 131 from ericoid mycorrhizal fungi (ErMF) and EcMF, and toward saprotrophic 132 basidiomycetes. ErMF primarily function to access limiting nutrients locked in 133 organic matter and can reduce saprotroph activity via nutrient competition 134 (Wiederman et al., 2017). In addition, saprotrophic basidiomycetes are 135 reported to have a higher nutrient requirement than ascomycetes that 136 dominate the ericoid mycorrhizal symbiosis (Treseder et al., 2018). N addition 137 has been shown to increase ecosystem C loss by reducing mycorrhizal fungal 138 activity, and probably enhancing saprotrophic activity (Vesala et al., 2021). 139 However, ErMF colonization in ericaceous shrub roots was found to increase 140 with fertilization at the same study site (Kiheri et al., 2020), potentially due to 141 the capacity of ErMF to switch from mutualistic to saprotrophic lifestyle 142 (Martino et al., 2018) or because colonization frequency may not reflect the 143 functional status of mycorrhizal interaction. Determining the shifts in the 144 composition of key fungal functional guilds in response to long-term changes 145 in N and P deposition becomes important considering their essential roles in 146 nutrient cycling and organic matter decomposition in peatlands. 147 Vertical stratification of fungal communities and metabolic activities is 148 often observed in peatlands in response to increasing anoxia, root distribution, 149 and changing substrate quality with depth (Andersen et al., 2013; Lamit et al., 150 2017, 2021; Lin et al., 2014b; Wang et al., 2019). It remains unclear whether 151 the vertical stratification of fungal communities is affected by nutrient 152 enrichment. The aforementioned nutrient-mediated shift in plant community 153 structure and root morphology may exert cascading effects on fungi, Page 6 of 51Global Change Biology 7 154 especially mycorrhizal fungi. For example, the deeper-rooted sedges which 155 lack mycorrhizal associations use aerenchyma to moderate the distinctive 156 resource gradient with depth by providing oxygen and root exudates to a 157 deeper layer than ericaceous shrubs, which lack aerenchyma (Lamit et al., 158 2017, 2021). In contrast, ericaceous shrubs may drive fungal community 159 differences between surface and subsurface layers owing to their C subsidy of 160 ErMF in the surface horizon where their roots reside (Lamit et al., 2017, 161 2021). 162 We used a pair of long-term nutrient addition experiments in an 163 ombrotrophic peatland in southeastern Canada to examine the influence of 164 nutrient addition on fungal communities. We specifically hypothesized that the 165 long-term addition of N, P and K will alter fungal community structure by (H1) 166 decreasing the relative abundance of ErMF and increasing the relative 167 abundance of saprotrophic species in general, and white-rot basidiomycetes 168 in particular; (H2) changing fungal relative abundance primarily in the 169 acrotelm while minimally in the catotelm; (H3) shifting the ectomycorrhizal 170 community from dominance by nitrophobic to nitrophilic taxa; and lastly, (H4) 171 reducing the relative abundance of Sphagnum-associated fungi driven by the 172 decline in Sphagnum cover. 173 174 2 | MATERIALS AND METHODS 175 2.1 | Study site 176 This study was conducted at Mer Bleue, an ombrotrophic peatland in 177 southeastern Ontario (45.41° N, 75.52° W). The mean annual air temperature 178 and precipitation are 6 °C and 943 mm, respectively (Canadian Climate 179 Normals, 1981-2010). The bog plant community is dominated by Ericaceae 180 (Rhododendron groenlandicum (Oeder) Kron & Judd, Chamaedaphne 181 calyculata (L.) Moench and Kalmia angustifolia L.) underlain by Sphagnum 182 mosses (mainly S. capillifolium (Ehrh.) Hedw. and S. magellanicum Brid.) and Page 7 of 51 Global Change Biology 8 183 Polytrichum strictum (Menzies ex Brid.). Deciduous shrubs (mainly Vaccinium 184 myrtilloides Michx.), sedges (Eriophorum vaginatum L.), and ectomycorrhizal 185 trees (Larix laricina (Du Roi) K.Koch, Picea mariana (Mill.) Britton, Sterns & 186 Poggenb. and Betula populifolia Marshall), are distributed sparsely. Of 187 particular relevance to fungal communities, a few scattered larger trees 188 (mostly B. populifolia and L. laricina) grew at the experimental site only after 189 the initiation of the experiment, likely a fertilization effect as this did not occur 190 away from the site. The effect of this patchy tree distribution was expected to 191 lead to patchy root colonization belowground, and hence add noise to our 192 analysis of EcMF communities. For more details on the Mer Bleue site see 193 Bubier et al. (2007) and Moore et al. (2019). 194 195 2.2 | Fertilization experiments 196 Two sets of fertilization experiments were established in 2000-2001 and 197 2005, respectively (Table 1). Experiment 1 included six treatments with 198 different rates of N additions with or without P and K. To better understand the 199 effect of different rates of N addition alone, Experiment 2 was established in 200 2005. In both experiments, triplicate plots (3 m x 3 m) were fertilized every 201 three weeks from early May to late August (7 times per year) by applying 202 ammonium nitrate (for N treatments) and/or mono potassium phosphate (for 203 PK treatments). The two experiments combined represented a total of 27 204 plots (9 treatments x 3 replicates) and were established on large hummocks 205 which covered 70% of the terrain. There have been no changes to the 206 distribution of hummocks versus hollows with the fertilization treatments. 207 The rates of N addition were chosen to complement the estimated annual 208 atmospheric deposition of 0.6 – 0.8 g N m-2 yr-1 in the Mer Bleue region and to 209 raise them to levels encountered in Europe and elsewhere, affected by 210 elevated N deposition, by adding 1.6, 3.2 and 6.4 g N m-2 yr-1 (Bubier et al., 211 2007). Rates of N2 fixation at Mer Bleue bog are small, ~0.3 g m-2 yr-1, Page 8 of 51Global Change Biology 9 212 compared to other peatlands (Yin et al., 2022) and are decreased by N 213 addition and increased by P addition (Živković et al., 2022). 214 215 2.3 | Vegetation survey 216 Plant communities were characterized by the point intercept method of 217 Larmola et al. (2013) in July 2014. The number of times (‘hits’) a specific plant 218 species and organ (leaf/woody stem/flower/moss shoot) contacted a metal rod 219 (4 mm in radius) over 61 grid points in a 60 cm x 60 cm frame were recorded. 220 Sphagnum cover (%) was estimated by the number of hits divided by 61 and 221 multiplying by 100. Vascular species abundance (not identical to cover) was 222 estimated by the total number of hits of all organs per m2 for each species. 223 224 2.4 | Peat sampling 225 In mid-July 2014, a single peat core was taken from a location selected at 226 random within each plot, with 3 depth increments saved per core (27 cores x 227 3 depth increments = 81 samples total). The upper two depth increments of 228 peat (10-20 and 30-40 cm below the peat surface, 10 cm length x 10 cm width 229 x 10 cm height) were collected using a clean bread knife, and an Eijkelkamp 230 auger (Eijkelkamp Soil & Water, Giesbeek, The Netherlands) was used for 231 deeper peat (60-70 cm, 5.2 cm diameter x 10 cm height). At Mer Bleue, the 232 uppermost layer (10-20 cm) represents the typical acrotelm peat which is 233 rarely saturated (i.e., oxic) while the lowermost layer (60-70 cm) is from the 234 catotelm where peat is rarely above the water table (i.e., anoxic). The middle 235 layer (30-40 cm) is from the mesotelm through which the water table has 236 seasonal oscillations and thus it is a biogeochemical ‘hotspot’ where roots 237 never dry out and are rarely exposed to anoxic conditions in the growing 238 season. At the time of collection, water table depth and the location of the 239 water table relative to the mid-point of the depth of the peat sample were 240 determined in each core hole and peat temperature was measured from each Page 9 of 51 Global Change Biology 10 241 depth increment. Samples were subdivided into two subsamples (for DNA 242 analyses and physicochemical analyses), transported to the laboratory on dry 243 ice, stored at -20°C, and shipped to the USDA Forest Service, Northern 244 Research station (Houghton, MI, USA) where they were stored at -20°C until 245 further processing. 246 247 2.5 | Physicochemical properties of peat 248 A variety of elemental concentrations, pH, humification index and organic 249 chemical composition of peat were measured. Using moist peat from each 250 sample, humification level was characterized using the von Post humification 251 index (Von Post, 1922), and peat pH was measured using a 2:1 ratio 252 (volume:volume) of distilled water to peat. A subsample of peat was oven- 253 dried at 60 °C to a constant weight and ground using a Wiley Mini Mill 254 (Thomas Scientific, Swedesboro, NJ, USA) with size 60 mesh. Total C, N, and 255 S concentrations were determined by dry combustion on a VarioMacro CNS 256 Analyzer (Elementar Gmbh, Langenselbold, Germany) in the Watmough lab 257 at Trent University as described in Watmough et al. (2022). P and K were 258 analyzed using ICP-MS (Varian 810, now part of Agilent Technologies, Santa 259 Clara, CA, USA) in the Spiers lab at Laurentian University after combustion 260 with a muffle furnace and a modified EPA3050A block digestion (see 261 Birnbaum et al., 2023 for details). Fourier-transform infrared spectroscopy 262 (FTIR) analysis of dried peat and assignment of peaks to carbohydrate and 263 aromatic classes was carried out in the Chanton lab at Florida State 264 University, as described in Verbeke et al. (2022). 265 266 2.6 | DNA extraction, amplicon library preparation and sequencing 267 In a 50 mL centrifuge tube, 10 mL of wet peat was placed with twenty 3.2 268 mm chrome-steel beads. The sample was pulverized for two minutes on a 269 modified mini-beadbeater-96 (BioSpec Products, Bartlesville, OK, USA). A Page 10 of 51Global Change Biology 11 270 subsample of 0.5 g pulverized peat was used for DNA extraction with a 271 PowerSoil® DNA Isolation Kit (MoBio Laboratories Inc., Carlsbad, CA, USA, 272 now Qiagen). The extraction procedure followed the manufacturer’s 273 instructions, with the addition of a 10-min vortex followed by incubation at 274 65 °C for 30-min, all in the C1 lysis buffer. DNA was cleaned using a MoBio 275 PowerClean® Pro DNA Clean-Up Kit and quantified with a Qubit Fluorometer 276 (Invitrogen, Life Technologies, Carlsbad, CA, USA). 277 Cleaned DNA extracts were pooled and sequenced at the U.S. 278 Department of Energy Joint Genome Institute (JGI, Walnut Creek, CA, USA). 279 The amplicon library preparation and sequencing were performed following 280 Joint Genome Institute Protocols for Illumina MiSeq community amplicon 281 sequencing (Coleman-Derr et al., 2016; Lamit et al., 2017). Briefly, the fungal 282 ITS2 region was targeted with the forward primer fITS9 283 (GAACGCAGCRAANNGYGA) (Ihrmark et al., 2012) and the reverse primer 284 ITS4 (TCCTCCGCTTATTGATATGC) (White et al., 1990). The full-length 285 primer was composed of an Illumina adapter, an 11-bp barcode unique to 286 each sample on the reverse primer, a 10-bp primer pad, a 3-bp spacer pad 287 and the primer sequence (Lamit et al., 2017). DNA samples were combined in 288 equimolar aliquots and sequenced on an Illumina Miseq platform (Illumina, 289 Inc., San Diego, CA, USA) with 2×300 bp chemistry. Eight samples were lost 290 due to poor sequencing, which occurred independently and were not 291 treatment or depth specific. 292 293 2.7 | Bioinformatics analyses 294 Paired-end reads were demultiplexed according to their unique barcodes 295 with Qiime 1.9.1 (Caporaso et al., 2010), and then PhiX 174, Illumina 296 adapters and human contaminants were filtered using BBduk 297 (https://sourceforge.net/projects/bbmap/). Cutadapt was used to remove 298 primers and paired-end reads were merged by BBmerge (Bushnell et al., Page 11 of 51 Global Change Biology 12 299 2017). The merged reads were discarded if the expected errors (calculated 300 based on error probabilities from Phred scores) exceeded one, if there were 301 Ns, or if the sequence length was shorter than 250-bp using USEARCH 302 (Edgar & Flyvbjerg, 2015). The ITS2 regions were extracted by ITSx 303 (Bengtsson-Palme et al., 2013). Reference-based chimeras were detected 304 with UCHIME2 (Edgar, 2016) using the UNITE database (2017-06-28 release; 305 https://unite.ut.ee/) (Nilsson et al., 2015). The subsequent reads were 306 dereplicated and operational taxonomic units (OTUs) clustered with the 307 default 97% similarity using USPARSE-OTU algorithm (Edgar, 2013). 308 The generated OTUs were assigned to taxonomy using Qiime with the 309 BLAST algorithm and UNITE database (2020-02-20 release). OTUs classified 310 as nonfungal, no BLAST hit, or assigned only to fungal class or higher, were 311 subjected to manual BLASTn searches in the NCBI nucleotide database. 312 Fungal OTUs were only retained if the BLASTn hits had a percent identity 313 match of at least 75%, with coverage of at least 50% of the sequence length, 314 and if there were no better matches with nonfungal organisms. Fungal OTUs 315 were assigned to putative functional guilds using FUNGuild and FungalTraits 316 (Põlme et al., 2020), and the assignments were refined, if necessary, based 317 on literature searches and our expertise in fungal ecology in peatlands (Wang 318 et al., 2024). The OTU matrix was rarefied using the number of sequences 319 corresponding to the sample with the least reads (i.e., 100,251). 320 321 2.8 | Statistical analyses 322 A variety of statistical analyses were used to address our hypotheses 323 about fertilization effects on fungal communities and their depth-dependency. 324 Except for the Permutational analysis of variance (PERMANOVA), statistical 325 analyses were performed on the two experiments separately. 326 Differences between fertilization treatments and sampling depths in OTU 327 richness, Shannon’s diversity index, Pielou’s evenness index, the relative Page 12 of 51Global Change Biology 13 328 abundances of different fungal functional guilds were examined using linear 329 mixed model with lmerTest package (Kuznetsova et al., 2017) in R 4.1.2 (R 330 Core Team, 2021). The linear mixed models included fertilization treatments, 331 sampling depths and their interactions as fixed factors (both were categorical 332 variables), and individual peat core as a random factor nested within 333 treatment. The mixed models were fitted with Kenward-Roger approximation 334 for F-test. If there was evidence for an interactive effect, emmeans package 335 (Lenth, 2021) was used to obtain marginal means and conducted post hoc 336 pairwise comparisons. If there was no evidence for an interactive effect, only 337 the main effects (fertilization treatment or sampling depth) were shown. 338 Differences between fertilization treatments in vegetation abundance (total 339 abundance of ericaceous shrubs, and cover of Sphagnum or Polytrichum 340 mosses) were assessed using one-way ANOVA followed by Tukey’s multiple 341 comparisons. The canonical analysis of principal coordinates (CAP; Anderson 342 & Willis, 2003) with Bray-Curtis dissimilarity was conducted to visualize the 343 overall responses of fungal community using PRIMER 7.0.21 (PRIMER-e, 344 Quest Research Limited, Auckland, New Zealand). 345 The PERMANOVA with Bray-Curtis dissimilarity was used to examine the 346 effects of fertilization treatments and sampling depths on OTU composition, 347 followed by a test of homogeneity of multivariance dispersions (PERMDISP), 348 using PRIMER 7.0.21. The PERMANOVA models included fertilization 349 treatments, sampling depths and their interactions as fixed factors, and 350 individual peat core as a random factor nested within treatment. The 351 PERMANOVAs were conducted for two experiments separately, as well as 352 the dataset with two experiments pooled together. The OTU matrices were 353 fourth-root transformed to downweight the influence of most abundant taxa 354 prior to the analysis. 355 The indicspecies package (De Cáceres & Legendre, 2009) was used to 356 identify OTUs with specific preferences to certain fertilization treatments or Page 13 of 51 Global Change Biology 14 357 sampling depths. The contribution of plants (total abundance of ericaceous 358 shrubs, and cover of Sphagnum or Polytrichum mosses) and environmental 359 variables (C, N, P and K concentrations; pH; von Post humification index; 360 concentrations of carbohydrates and aromatic compounds; relative water 361 table depth) to Sphagnum-associated fungal composition was assessed by 362 hierarchical partitioning using rdacca.hp package. The hierarchical partitioning 363 algorithm enables the estimation of the relative importance of individual 364 predictors by considering their unique contribution to the total model R2, along 365 with their average shared contributions with other predictors, which is useful 366 when dealing with complex datasets when there are potential collinearities 367 among predictors (or matrices of predictors) (Lai et al., 2022). It calculates the 368 variable importance from all subset models, leading to an unordered 369 assessment of importance. Variables with negative values of ‘individual 370 importance’ (Supplementary Table S1) correspond to cases where the 371 predictor variables explain less variation than random normal variables and 372 therefore were removed until all remaining variables had positive values. 373 Eventually the ‘individual percent’ (i.e., the individual effect of each variable 374 divided by total adjusted R2 from ‘individual importance’) were used to show 375 the relative contribution of plants and environmental variables to the 376 compositions of Sphagnum-associated fungi (Supplementary Table S1). 377 In this study, we adopt a language of evidence, following the approach 378 outlined by Muff et al. (2021). Instead of describing results as significant or 379 not, we describe our results along a spectrum of evidence, ranging from very 380 strong evidence (equivalent to p < 0.001), strong evidence (p < 0.01), 381 moderate evidence (p < 0.05), weak evidence (p < 0.1), to no evidence (p ≥ 382 0.1). 383 384 3 | RESULTS 385 3.1 | Fungal composition and diversity responses to fertilization Page 14 of 51Global Change Biology 15 386 The rarefied dataset contained 73 samples (n = 48 in Experiment 1, and n 387 = 25 in Experiment 2; see Materials and Methods for details of missing 388 samples) and 7,318,323 sequences in total (4,812,048 per Experiment 1, and 389 2,506,275 per Experiment 2), with an average of 220 OTUs per sample (SD = 390 110, Range = 63-537). Overall, fungal communities were dominated by 391 Helotiales (Ascomycota), followed by Agaricales (Basidiomycota), 392 Mortierellales (Mortierellomycota), Sebacinales (Basidiomycota) and 393 Thelephorales (Basidiomycota) (Figure 1). 394 At the genus level, there was weak evidence that the relative abundance 395 of the dominant ErMF genus Hyaloscypha (formerly Pezoloma, Fehrer et al., 396 2019) decreased after N+PK additions (p < 0.1; Figure 3a; Table S4). 397 Additionally, there was weak to moderate evidence that the relative 398 abundances of Mortierella (p < 0.05), Thelephora (p < 0.05) and Trechispora 399 (p < 0.1) increased after the additions of N and N+PK at high rates. 400 We found that long-term N addition shifted fungal community diversity and 401 composition, and these effects tended to be most pronounced when P and K 402 were also added. There was moderate evidence that N+PK additions 403 increased Shannon’s diversity index (p < 0.05) via the concomitant increase of 404 OTU richness and Pielou’s evenness (p < 0.05; Table 3). Moreover, there was 405 moderate to very strong evidence that both treatment (p < 0.05) and depth (p 406 < 0.001) affected fungal OTU composition, while there was no evidence for an 407 interaction between treatment and depth (p > 0.1; Figure 2; Table 2). Fungal 408 indicator OTUs of the control were mainly EcMF and endophytes, whereas 409 fertilization (especially N+PK) increased the relative abundance of 410 saprotrophs and pathogens (Table S2). 411 412 3.2 | Effect of fertilization on functional guilds 413 In support of H1, there was weak to moderate evidence that N+PK 414 additions decreased the relative abundance of ErMF (p < 0.05; Figure 4b; Page 15 of 51 Global Change Biology 16 415 Table S5), and increased the relative abundances of lignocellulose-degrading 416 fungi (p < 0.1; Figure 5a), saprotrophs (p < 0.05; Figure 5d) and dark septate 417 root endophyte (p < 0.1; Figure S1a). However, except for EcMF, the results 418 of fertilization effect on the relative abundance of mycorrhizal or saprotrophic 419 fungi at different depths did not support H2. Unexpectedly, there was very 420 strong evidence that the effect of N+PK additions on ErMF abundance was 421 most profound at the depth of 60-70 cm in Experiment 1 (p < 0.001; Figure 422 4b). In contrast, there was moderate evidence for the strongest effect of N- 423 only addition on EcMF abundance at the depth of 10-20 cm in Experiment 2 424 (p < 0.05; Figure 4f; Table S5). Additionally, there was no evidence for depth- 425 dependent responses to nutrient additions for lignocellulose-degrading and 426 other saprotrophic fungi, and dark septate root endophytes(p > 0.1; Figures 5 427 and S1). 428 The results of fertilization effect on nitrophilic and nitrophobic taxa of 429 EcMF community did not support H3. There was, to the contrary, weak to 430 moderate evidence that the additions of N+PK (p < 0.1) or high rate of N 431 individually (3.2 and 6.4N; p < 0.05) increased the relative abundance of 432 EcMF (Figure 4d), including both the nitrophobic and nitrophilic taxa (Table 4). 433 The relative abundance of Sphagnum-associated fungi decreased after 434 nutrient additions and was apparently better predicted by fertilization than 435 Sphagnum cover (Table S1), which did not support H4. There was weak 436 evidence that PK, 3.2N+PK and 6.4N treatments decreased the relative 437 abundance of Sphagnum-associated fungi (p < 0.1; Figure 4g; Table S6). 438 Additionally, there was weak evidence that the most abundant Sphagnum- 439 associated fungal species, Clavaria sphagnicola, declined after PK or N+PK 440 additions (p < 0.1; Figure S2a), while the second most abundant species, 441 Entoloma chamaemori, remained largely unaffected. Similarly, there was 442 weak evidence that N additions (especially at high rates) increased the 443 relative abundance of C. sphagnicola but decreased that of E. chamaemori, Page 16 of 51Global Change Biology 17 444 Hygrocybe miniata, Pseudoplectania episphagnum, and Galerina spp. (p < 445 0.1; Figure S2a). 446 447 3.3 | Vertical stratification of functional guilds 448 There was moderate evidence that OTU composition at 60-70 cm differed 449 most strongly from the 10-20 cm depth (p < 0.05; Figure 2b). Similarly, there 450 was moderate to strong evidence that OTU richness declined with depth (p < 451 0.01), while Pielou’s evenness increased with depth (p < 0.05; Table 3). 452 The lower relative abundance of mycorrhizal functional guilds at the deep 453 peat layer and the lack of vertical stratification for other functional guilds only 454 partially supported H2. There was moderate to strong evidence that the 455 relative abundances of ErMF was the lowest at the depth of 60-70 cm after 456 the addition of N (p < 0.05) or PK (p < 0.01) individually in Experiment 1 457 (Figure 4b). Similarly, there was strong evidence that a sharp decline in the 458 relative abundance of ErMF at the depth of 60-70 cm compared to the upper 459 two depths was observed in Experiment 2 (p < 0.01; Figure 4c; Table S5). 460 Additionally, there was strong evidence that the relative abundance of EcMF 461 decreased with depth under the 6.4N treatment (p < 0.01; Figure 4f). No 462 evidence of vertical stratification was observed for Sphagnum-associated 463 fungi (p > 0.1; Figure 4h,i), lignocellulose-degrading fungi (p > 0.1; Figure 464 5b,c), saprotrophs (p > 0.1; Figure 5e,f), or dark septate root endophytes (p > 465 0.1; Figure S1b,c). 466 467 3.4 | Effect of fertilization on vegetation abundance 468 Responses of plant community to fertilization were primarily exhibited by 469 the moss layer. There was no evidence that the abundance of Ericaceae (at 470 the family-level) responded to fertilization (p > 0.1), with moderate evidence 471 that the abundance of C. calyculata increased at the 3.2N treatment 472 compared to the control (p < 0.05; Figure 6a). In contrast, there was moderate Page 17 of 51 Global Change Biology 18 473 to strong evidence that N, PK or N+PK fertilizations generally reduced the 474 cover of Sphagnum (p < 0.01) and Polytrichum mosses (p < 0.05), with 475 stronger effect of N+PK than N-only treatments (Figure 6b,c). 476 477 4 | DISCUSSION 478 4.1 | Fungal community responses to fertilization: overall effects 479 Long-term N addition did not strongly alter fungal diversity, except at the 480 highest rate, which even enriched fungal diversity, contrasting with the 481 consensus that fertilization often reduces fungal diversity (Allison et al., 2007; 482 Liu et al., 2012). Our finding that the changes in fungal guild were more 483 pronounced with the addition of N+PK vs. N alone could be related to a 484 tendency of N and P co-limitation of plant and microbial communities at Mer 485 Bleue bog (Larmola et al., 2013; Wang et al., 2016). 486 487 4.2 | Mycorrhizal versus saprotrophic fungi in response to fertilization 488 Our previous work using quantitative PCR of a fungal DNA marker 489 suggested minimal change in absolute fungal biomass after N+PK additions 490 (Guo, 2015), which supports the interpretation that the decrease in relative 491 abundance of ErMF in our study reflects the suppression of ErMF (i.e., decline 492 in absolute abundance) instead of the stimulation of other guilds. This decline 493 might reflect lower allocation by hosts to ErMF partners under elevated 494 nutrient availability. ErMF might also be suppressed because the loss of living 495 Sphagnum and Polytrichum mosses has led to peat subsidence (Juutinen et 496 al., 2018), which increased soil wetness, unfavorable to either partner in the 497 ericoid mycorrhizal symbiosis. 498 In contrast to ErMF, we found that dark septate root endophytes were 499 more abundant in N or N+PK additions. Dark septate root endophytic fungi 500 may be better adapted to periodic waterlogged conditions than mycorrhizal 501 fungi in peatlands (e.g., Kiheri et al., 2020). The role of dark septation root Page 18 of 51Global Change Biology 19 502 endophytic fungi in soil organic matter decomposition warrants additional 503 study (Netherway et al., 2024). 504 The observed increase in saprotrophs concomitant with the decrease in 505 ErMF bears further examination from a functional perspective. The increase in 506 the abundance of saprotrophs, especially lignocellulose-degrading fungi at the 507 expense of mycorrhizal fungi after fertilization, could weaken the ‘Gadgil 508 effect’, where the competition between mycorrhizal and saprotrophic fungi 509 leads to the suppression of decomposition (Fernandez & Kennedy, 2016; 510 Gadgil & Gadgil, 1975), and might contribute to the enhanced organic matter 511 decomposition in northern peatlands (Larmola et al., 2013; Limpens et al., 512 2011). However, N addition can also lead to suppression of decomposition 513 and soil oxidative enzyme activity (e.g., Berg & Matzner, 1997; Bowden et al., 514 2019). Such altered community functional changes likely represent impacts on 515 both saprotroph- and mycorrhizally-mediated decomposition (Lindahl & 516 Tunlid, 2015; Zak et al., 2019), so changes observed in these communities in 517 the present study justify deeper investigation into the links between fertility, 518 fungal community composition, and decomposition in peatlands (Defrenne et 519 al., 2023). 520 In contrast, the increased relative abundance of EcMF under N+PK 521 addition and high rate of N addition runs counter to the general finding of 522 decrease in mycorrhizal abundance after fertilization (Lilleskov et al., 2024). A 523 key difference in the present study is the fertilization effect on tree 524 encroachment on these peatlands. The invasion of trees has been observed 525 in several heavily fertilized plots (T.R. Moore et al., unpublished), which may 526 account for the increasing abundance of EcMF related to the control. We 527 hypothesize that the different responses of ErMF and EcMF may be amplified 528 by differential C allocation belowground between shrubs and trees in 529 response to nutrient patches: whereas belowground allocation by shrubs 530 would likely be suppressed by complete fertilization (i.e., N+PK), that by trees Page 19 of 51 Global Change Biology 20 531 could be stimulated. This likely difference arises from the experimental design 532 of the current study, in which the size of the plots (3 m x 3 m) encompasses 533 entire shrub plants, but only small portions of the root systems of the trees, 534 favoring preferential tree root proliferation in nutrient-enriched plots (e.g., 535 Hodge, 2004). The differences in the foraging strategy of the Ericaceae 536 versus tree root systems would only reinforce this. Bog specialist Ericaceae 537 roots form adventitiously on buried shrub stems and do not extend far from 538 those stems (Lems, 1956; MacDonald et al., 1995), constraining them to the 539 plot in which they are growing; in contrast, ectomycorrhizal tree roots explore 540 very long distances from the tree stem while foraging for nutrients (Putz et al., 541 2024; Lilleskov, unpublished). Foraging tree roots would be likely to encounter 542 and proliferate preferentially in these nutrient-enriched hot spots, increasing 543 overall abundance of tree roots relative to Ericaceae shrub roots. Large tree 544 hosts have a strong demand for nutrients, increasing belowground C 545 allocation in these patches (Prescott et al., 2020). This hypothesized driver of 546 counterintuitive EcMF responses to fertilization requires experimental testing. 547 548 4.3 | Effects of fertilization on mycorrhizal fungi abundance are depth- 549 dependent 550 The nature of the interaction effects between fertilization and depth on the 551 relative abundance of ErMF and EcMF was surprising. We anticipated a more 552 substantial and consistent effect of fertilization in the oxic acrotelm than in the 553 anoxic catotelm where most fungi are not expected to survive. Although the 554 majority of Ericaceae roots were distributed in the top 20 cm of the surface 555 peat at Mer Bleue (Murphy, 2009), the lack of a clear N+PK effect in the 556 shallowest layer stood in contrast with the strong evidence for fertilization 557 effects in the deepest peat. This could be in part to do with higher variability 558 within treatments at the surface, as mean effects were quite substantial. The 559 substantial presence of ErMF at depth contrasts with the pattern of Page 20 of 51Global Change Biology 21 560 stratification of fungal abundance observed in the PEATcosm mesocosm 561 study with Sphagnum peat monoliths (without fertilization), in which there 562 were few ErMF below 30-40 cm (Lamit et al., 2021). The acrotelm–catotelm 563 boundary was located at ~25 cm depth in PEATcosm (Lamit et al., 2021) vs. 564 ~40 cm depth with strong seasonal oscillations from ~25 to 65 cm depth at 565 Mer Bleue (Juutinen et al., 2010, 2018). This thicker acrotelm at Mer Bleue 566 may explain the greater presence of ErMF at depth in the current study. 567 Furthermore, the subsidence of peat surface in heavily fertilized plots (e.g., 568 6.4N and 6.4N+PK) led to the rise in water table to ~20 cm depth (Juutinen et 569 al., 2018). This thinner acrotelm after subsidence may contribute to the 570 decrease of ErMF abundance in N+PK fertilized plots, in which no vertical 571 stratification of ErMF community was detected. 572 573 4.4 | Nitrogen addition did not shift the ectomycorrhizal community from 574 nitrophobic to nitrophilic taxa 575 The lack of a clear shift in ectomycorrhizal community from nitrophobic to 576 nitrophilic taxa after N addition, or in the relative abundances of several typical 577 nitrophobic EcMF, e.g., Cortinarius and Suillus spp. (Lilleskov et al., 2001, 578 2002, 2011, 2024), were unexpected. Given the nutrient-deficient nature of 579 northern acidic peatlands, the addition of N will likely lead to P-limitation and 580 vice versa (Wang et al., 2016). Therefore, we hypothesize that the increase of 581 these EcMF may be owing to continued high C allocation into the nutrient hot 582 spots hypothesized earlier in the discussion, which are expected to be 583 especially enhanced under continued N or P limitation (Lilleskov et al., 2024). 584 The continued persistence of nitrophobes, especially Cortinarius, under these 585 N enriched conditions indicates that high N availability is not always sufficient 586 to decrease the abundance of so-called nitrophobic fungi, consistent with the 587 alternative hypothesis that C allocation, rather than nutrient supply per se, can 588 regulate nitrophobe and nitrophile relative abundance (Poznanovic et al., Page 21 of 51 Global Change Biology 22 589 2015; Lilleskov et al., 2024). Poznanovic et al. (2015) found that so-called 590 nitrophilic mycorrhizal fungi dominated on seedling roots in very high C:N 591 woody debris under very dense shade, consistent with adaptation to C 592 limitation rather than excess N. Therefore, it would be particularly enlightening 593 to test the effect of spatial scale of fertilizer additions, and co-limitation by N & 594 P, on C allocation to roots and associated ectomycorrhizal fungal community 595 response. 596 597 4.5 | Sphagnum-associated fungi in response to fertilization 598 The parallel decline in Sphagnum cover and the total relative abundance 599 of Sphagnum-associated fungi after N, and especially N+PK, additions begs 600 the question of whether the decline is driven simply by loss of Sphagnum or 601 by the nutrient treatments. The results of the hierarchical analysis support the 602 overarching role of limiting nutrients on fungal communities rather than the 603 loss of Sphagnum alone, consistent with the results observed in a bog-fen 604 peatland complex in northeastern China (Cao et al., 2022). Sphagnum- 605 associated fungi can be mutualists, symbionts or antagonists of Sphagnum 606 mosses (Kostka et al., 2016). However, the relationship between species 607 identity and its role is still unknown. Whether there is a species-specific 608 association between certain Sphagnum-associated fungi and their hosts, and 609 how it affects peatland C dynamics should be addressed, given the critical 610 role of Sphagnum mosses as ecosystem engineers in northern peatlands (van 611 Breemen, 1995). Surprisingly, Polytrichum cover showed the strongest effect 612 on Sphagnum-associated fungal community. The higher Polytrichum cover 613 under moderate rates of N addition supported the competitive advance of 614 Polytrichum over Sphagnum mosses via allocating excess N to growth (Bu et 615 al., 2011; Mitchell et al., 2002). 616 617 5 | CONCLUSIONS Page 22 of 51Global Change Biology 23 618 The imbalance between N and P exerts uncertain influence on peatlands 619 with naturally low nutrient input, especially on decomposers. We saw strong 620 effects of high nutrient additions in restructuring peatland fungal communities, 621 especially with the combination of N and PK, which is in line with the nature of 622 previously demonstrated N and P co-limitation at Mer Bleue. The negative 623 response of ErMF in relative abundance to N and PK additions is 624 accompanied by increasing relative abundance of saprotrophs, especially 625 lignocellulose-degrading fungi. This shift in the composition of functional 626 guilds after fertilization could affect peatland C stocks via the superior 627 capacity of lignocellulose-degrading fungi to decompose recalcitrant organic 628 matter. Possibly owing to the strong fluctuations of water table and 629 subsidence of peat surface after years of heavy fertilization, we generally do 630 not observe a greater effect of nutrient addition in the acrotelm than the 631 catotelm, in which the occasional exposure to oxygen may account for the 632 modest abundance of ErMF. The persistence of nitrophobic fungi under N 633 addition may point to their sensitivity to high C allocation instead of nutrient 634 supply, suggesting the need to explore fungal community response to nutrient 635 hotspots of different sizes. Given the overarching role of limiting nutrients in 636 structuring fungal community, it is likely that nutrient addition rather than 637 decline in Sphagnum cover accounts for the drastic decline in the relative 638 abundance of Sphagnum-associated fungi. Page 23 of 51 Global Change Biology 24 639 AUTHOR CONTRIBUTIONS 640 Meng Wang: Conceptualization (lead); methodology (lead); writing – original 641 draft (lead); formal analysis (lead); writing – review and editing (equal); 642 funding acquisition (lead). Louis J. Lamit: Conceptualization (supporting); 643 formal analysis (supporting); writing – review and editing (equal). Erik A. 644 Lilleskov: Conceptualization (supporting); formal analysis (supporting); 645 methodology (supporting); writing – review and editing (equal); funding 646 acquisition (lead). Nathan Basiliko: Formal analysis (supporting); writing – 647 review and editing (equal). Tim Moore: Writing – review and editing (equal); 648 funding acquisition (supporting). Jill Bubier: Writing – review and editing 649 (equal); funding acquisition (supporting). Galen Guo: Formal analysis 650 (supporting); methodology (supporting); writing – review and editing (equal). 651 Sari Juutinen: Writing – review and editing (equal); funding acquisition 652 (supporting). Tuula Larmola: Writing – review and editing equal); funding 653 acquisition (supporting). 654 655 ACKNOWLEDGEMENTS 656 This study was funded by the National Natural Science Foundation of China 657 to MW (42371097, 42330509), the Natural Sciences and Engineering 658 Research Council of Canada to TM, the U.S. National Science Foundation 659 (DEB 1019523) to JB, TL and SJ, and the Research Council of Finland to TL 660 (286731, 293365, 319262). The DNA sequencing work was supported by the 661 USDA Forest Service Northern Research Station Climate Change Program, 662 the US National Science Foundation (DEB 1146149), and the U.S. 663 Department of Energy Joint Genome Institute Community Science Program 664 (Proposal ID 1445). The work conducted by the U.S. Department of Energy 665 Joint Genome Institute, a DOE Office of Science User Facility, is supported by 666 the Office of Science of the U.S. Department of Energy under Contract No. 667 DE-AC02-05CH11231. We thank Graeme Spiers of Laurentian University, Page 24 of 51Global Change Biology 25 668 Shaun Watmough of Trent University, Jeffrey P. Chanton and Brittany A. 669 Verbeke of Florida State University for providing chemical data. 670 671 CONFLICT OF INTEREST STATEMENT 672 The authors declare no conflict of interest. 673 674 DATA AVAILABILITY STATEMENT 675 Sequence data are accessible via the National Center for Biotechnology 676 Information (PRJNA1059234). The data that support the findings of this study 677 are openly available in Dryad at https://doi.org/10.5061/dryad.kh18932hd. 678 679 REFERENCES 680 Ackerman, D., Millet, D. B., & Chen, X. (2019). Global estimates of inorganic 681 nitrogen deposition across four decades. Global Biogeochemical 682 Cycles, 33(1), 100-107. https://doi.org/10.1029/2018gb005990 683 Allison, S. D., Hanson, C. A., & Treseder, K. K. (2007). Nitrogen fertilization 684 reduces diversity and alters community structure of active fungi in 685 boreal ecosystems. Soil Biology and Biochemistry, 39(8), 1878-1887. 686 https://doi.org/10.1016/j.soilbio.2007.02.001 687 Andersen, R., Chapman, S. J., & Artz, R. R. E. (2013). Microbial communities 688 in natural and disturbed peatlands: A review. Soil Biology and 689 Biochemistry, 57, 979-994. https://doi.org/10.1016/j.soilbio.2012.10.003 690 Anderson, M. J., & Willis, T. J. (2003). Canonical analysis of principal 691 coordinates: a useful method of constrained ordination for ecology. 692 Ecology, 84(2), 511-525. https://doi.org/10.1890/0012- 693 9658(2003)084[0511:CAOPCA]2.0.CO;2 694 Basiliko, N., Moore, T. R., Jeannotte, R., & Bubier, J. L. (2006). Nutrient input 695 and carbon and microbial dynamics in an ombrotrophic bog. 696 Geomicrobiology Journal, 23(7), 531-543. Page 25 of 51 Global Change Biology https://doi.org/10.1029/2018gb005990 https://doi.org/10.1016/j.soilbio.2007.02.001 https://doi.org/10.1016/j.soilbio.2012.10.003 https://doi.org/10.1890/0012-9658(2003)084%5b0511:CAOPCA%5d2.0.CO;2 https://doi.org/10.1890/0012-9658(2003)084%5b0511:CAOPCA%5d2.0.CO;2 26 697 https://doi.org/10.1080/01490450600897278 698 Bengtsson, F., Rydin, H., & Hájek, T. (2018). Biochemical determinants of 699 litter quality in 15 species of Sphagnum. Plant and Soil, 425(1), 161- 700 176. https://doi.org/10.1007/s11104-018-3579-8 701 Bengtsson-Palme, J., Ryberg, M., Hartmann, M., Branco, S., Wang, Z., 702 Godhe, A., De Wit, P., Sánchez-García, M., Ebersberger, I., de Sousa, 703 F., Amend, A., Jumpponen, A., Unterseher, M., Kristiansson, E., 704 Abarenkov, K., Bertrand, Y. J. K., Sanli, K., Eriksson, K. M., Vik, U., … 705 Nilsson, R. H. (2013). Improved software detection and extraction of 706 ITS1 and ITS2 from ribosomal ITS sequences of fungi and other 707 eukaryotes for analysis of environmental sequencing data. Methods in 708 Ecology and Evolution, 4(10), 914-919. https://doi.org/10.1111/2041- 709 210X.12073 710 Berg, B., & Matzner, E. (1997). Effect of N deposition on decomposition of 711 plant litter and soil organic matter in forest systems. Environmental 712 Reviews, 5(1), 1-25. https://doi.org/10.1139/a96-017 713 Birnbaum, C., Wood, J., Lilleskov, E., Lamit, L. J., Shannon, J., Brewer, M., & 714 Grover, S. (2023). Degradation reduces microbial richness and alters 715 microbial functions in an Australian peatland. Microbial Ecology, 85(3), 716 875-891. https://doi.org/10.1007/s00248-022-02071-z 717 Bowden, R. D., Wurzbacher, S. J., Washko, S. E., Wind, L., Rice, A. M., 718 Coble, A. E., Baldauf, N., Johnson, B., Wang, J. J., Simpson, M., & 719 Lajtha, K. (2019). Long-term nitrogen addition decreases organic 720 matter decomposition and increases forest soil carbon. Soil Science 721 Society of America Journal, 83(S1), S82-S95. 722 https://doi.org/10.2136/sssaj2018.08.0293 723 Bragazza, L., Buttler, A., Habermacher, J., Brancaleoni, L., Gerdol, R., Fritze, 724 H., Hanajík, P., Laiho, R., & Johnson, D. (2012). High nitrogen 725 deposition alters the decomposition of bog plant litter and reduces Page 26 of 51Global Change Biology https://doi.org/10.1080/01490450600897278 https://doi.org/10.1007/s11104-018-3579-8 https://doi.org/10.1111/2041-210X.12073 https://doi.org/10.1111/2041-210X.12073 https://doi.org/10.1007/s00248-022-02071-z https://doi.org/10.2136/sssaj2018.08.0293 27 726 carbon accumulation. Global Change Biology, 18(3), 1163-1172. 727 https://doi.org/10.1111/j.1365-2486.2011.02585.x 728 Bridgham, S. D., Pastor, J., Janssens, J. A., Chapin, C., & Malterer, T. J. 729 (1996). Multiple limiting gradients in peatlands: A call for a new 730 paradigm. Wetlands, 16(1), 45-65. https://doi.org/10.1007/BF03160645 731 Bu, Z.-J., Rydin, H., & Chen, X. (2011). Direct and interaction-mediated 732 effects of environmental changes on peatland bryophytes. Oecologia, 733 166(2), 555-563. https://doi.org/10.1007/s00442-010-1880-1 734 Bubier, J. L., Moore, T. R., & Bledzki, L. A. (2007). Effects of nutrient addition 735 on vegetation and carbon cycling in an ombrotrophic bog. Global 736 Change Biology, 13(6), 1168-1186. https://doi.org/10.1111/j.1365- 737 2486.2007.01346.x 738 Bushnell, B., Rood, J., & Singer, E. (2017). BBMerge – Accurate paired 739 shotgun read merging via overlap. PLoS One, 12(10), e0185056. 740 https://doi.org/10.1371/journal.pone.0185056 741 Cao, C., Huang, J., Ge, L., Li, T., Bu, Z.-J., Wang, S., Wang, Z., Liu, Z., Liu, 742 S. and Wang, M. (2022). Does shift in vegetation abundance after 743 nitrogen and phosphorus additions play a key role in regulating fungal 744 community structure in a northern peatland? Frontiers in Microbiology, 745 13, 920382. https://doi.org/10.3389/fmicb.2022.920382 746 Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D., 747 Costello, E. K., Fierer, N., Pena, A. G., Goodrich, J. K., Gordon, J. I., 748 Huttley, G. A., Kelley, S. T., Knights, D., Koenig, J. E., Ley, R. E., 749 Lozupone, C. A., McDonald, D., Muegge, B. D., Pirrung, M., … Knight, 750 R. (2010). QIIME allows analysis of high-throughput community 751 sequencing data. Nature Methods, 7(5), 335-336. 752 https://doi.org/10.1038/nmeth.f.303 753 Charman, D. (2002). Peatlands and Environmental Change. Wiley. 754 Coleman-Derr, D., Desgarennes, D., Fonseca-Garcia, C., Gross, S., Page 27 of 51 Global Change Biology https://doi.org/10.1111/j.1365-2486.2011.02585.x https://doi.org/10.1007/BF03160645 https://doi.org/10.1007/s00442-010-1880-1 https://doi.org/10.1111/j.1365-2486.2007.01346.x https://doi.org/10.1111/j.1365-2486.2007.01346.x https://doi.org/10.1371/journal.pone.0185056 https://doi.org/10.3389/fmicb.2022.920382 https://doi.org/10.1038/nmeth.f.303 28 755 Clingenpeel, S., Woyke, T., North, G., Visel, A., Partida-Martinez, L. P., 756 & Tringe, S. G. (2016). Plant compartment and biogeography affect 757 microbiome composition in cultivated and native Agave species. New 758 Phytologist, 209(2), 798-811. https://doi.org/10.1111/nph.13697 759 De Cáceres, M., & Legendre, P. (2009). Associations between species and 760 groups of sites: indices and statistical inference. Ecology, 90(12), 3566- 761 3574. https://doi.org/10.1890/08-1823.1 762 Defrenne, C. E., Moore, J. A., Tucker, C. L., Lamit, L. J., Kane, E. S., Kolka, 763 R. K., Chimner, R. A., Keller, J. K., & Lilleskov, E. A. (2023). Peat loss 764 collocates with a threshold in plant–mycorrhizal associations in drained 765 peatlands encroached by trees. New Phytologist, 240(1), 412-425. 766 https://doi.org/10.1111/nph.18954 767 Du, E., Terrer, C., Pellegrini, A. F. A., Ahlström, A., van Lissa, C. J., Zhao, X., 768 Xia, N., Wu, X., & Jackson, R. B. (2020). Global patterns of terrestrial 769 nitrogen and phosphorus limitation. Nature Geoscience, 13, 221-226. 770 https://doi.org/10.1038/s41561-019-0530-4 771 Edgar, R. C. (2013). UPARSE: highly accurate OTU sequences from 772 microbial amplicon reads. Nature Methods, 10(10), 996-998. 773 https://doi.org/10.1038/nmeth.2604 774 Edgar, R. C. (2016). UCHIME2: improved chimera prediction for amplicon 775 sequencing. bioRxiv, 074252. https://doi.org/10.1101/074252 776 Edgar, R. C., & Flyvbjerg, H. (2015). Error filtering, pair assembly and error 777 correction for next-generation sequencing reads. Bioinformatics, 778 31(21), 3476-3482. https://doi.org/10.1093/bioinformatics/btv401 779 Fehrer, J., Réblová, M., Bambasová, V., & Vohník, M. (2019). The root- 780 symbiotic Rhizoscyphus ericae aggregate and Hyaloscypha 781 (Leotiomycetes) are congeneric: Phylogenetic and experimental 782 evidence. Studies in Mycology, 92(1), 195-225. 783 https://doi.org/10.1016/j.simyco.2018.10.004 Page 28 of 51Global Change Biology https://doi.org/10.1111/nph.13697 https://doi.org/10.1890/08-1823.1 https://doi.org/10.1111/nph.18954 https://doi.org/10.1038/s41561-019-0530-4 https://doi.org/10.1038/nmeth.2604 https://doi.org/10.1101/074252 https://doi.org/10.1093/bioinformatics/btv401 https://doi.org/10.1016/j.simyco.2018.10.004 29 784 Fenner, N., & Freeman, C. (2020). Woody litter protects peat carbon stocks 785 during drought. Nature Climate Change, 10(4), 363-369. 786 https://doi.org/10.1038/s41558-020-0727-y 787 Fernandez, C. W., & Kennedy, P. G. (2016). Revisiting the ‘Gadgil effect’: do 788 interguild fungal interactions control carbon cycling in forest soils? New 789 Phytologist, 209(4), 1382-1394. https://doi.org/10.1111/nph.13648 790 Fritz, C., van Dijk, G., Smolders, A. J. P., Pancotto, V. A., Elzenga, T., 791 Roelofs, J. G. M., & Grootjans, A. P. (2012). Nutrient additions in 792 pristine Patagonian Sphagnum bog vegetation: can phosphorus 793 addition alleviate (the effects of) increased nitrogen loads. Plant 794 Biology, 14(3), 491-499. https://doi.org/10.1111/j.1438- 795 8677.2011.00527.x 796 Gadgil, R. L., & Gadgil, P. D. (1975). Suppression of litter decomposition by 797 mycorrhizal roots of Pinus radiata. New Zealand Journal of Forestry 798 Science, 5, 33-41. 799 Guo, G. (2015). Chronic N and nutrient deposition impact on diversity and 800 abundance of bacteria, fungi, and CH4 cycling prokaryotes at a 801 northern peat bog. (Master of Science). Laurentian University, 802 Sudbury, Canada. 803 Hill, B. H., Elonen, C. M., Jicha, T. M., Kolka, R. K., Lehto, L. L. P., 804 Sebestyen, S. D., & Seifert-Monson, L. R. (2014). Ecoenzymatic 805 stoichiometry and microbial processing of organic matter in northern 806 bogs and fens reveals a common P-limitation between peatland types. 807 Biogeochemistry, 120(1), 203-224. https://doi.org/10.1007/s10533-014- 808 9991-0 809 Hodge, A. (2004). The plastic plant: root responses to heterogeneous 810 supplies of nutrients. New Phytologist, 162(1), 9-24. 811 https://doi.org/10.1111/j.1469-8137.2004.01015.x 812 Hoosbeek, M. R., van Breemen, N., Vasander, H., Buttler, A., & Berendse, F. Page 29 of 51 Global Change Biology https://doi.org/10.1038/s41558-020-0727-y https://doi.org/10.1111/nph.13648 https://doi.org/10.1111/j.1438-8677.2011.00527.x https://doi.org/10.1111/j.1438-8677.2011.00527.x https://doi.org/10.1007/s10533-014-9991-0 https://doi.org/10.1007/s10533-014-9991-0 https://doi.org/10.1111/j.1469-8137.2004.01015.x 30 813 (2002). Potassium limits potential growth of bog vegetation under 814 elevated atmospheric CO2 and N deposition. Global Change Biology, 815 8(11), 1130-1138. https://doi.org/10.1046/j.1365-2486.2002.00535.x 816 Hupperts, S. F., & Lilleskov, E. A. (2022). Predictors of taxonomic and 817 functional composition of black spruce seedling ectomycorrhizal fungal 818 communities along peatland drainage gradients. Mycorrhiza, 32(1), 67- 819 81. https://doi.org/10.1007/s00572-021-01060-3 820 Ihrmark, K., Bödeker, I. T. M., Cruz-Martinez, K., Friberg, H., Kubartova, A., 821 Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., 822 Clemmensen, K. E., & Lindahl, B. D. (2012). New primers to amplify 823 the fungal ITS2 region - evaluation by 454-sequencing of artificial and 824 natural communities. FEMS Microbiology Ecology, 82(3), 666-677. 825 https://doi.org/10.1111/j.1574-6941.2012.01437.x 826 Juutinen, S., Bubier, J., & Moore, T. (2010). Responses of vegetation and 827 ecosystem CO2 exchange to 9 years of nutrient addition at Mer Bleue 828 bog. Ecosystems, 13(6), 874-887. https://doi.org/10.1007/s10021-010- 829 9361-2 830 Juutinen, S., Moore, T. R., Bubier, J. L., Arnkil, S., Humphreys, E., Marincak, 831 B., Roy, C., & Larmola, T. (2018). Long-term nutrient addition 832 increased CH4 emission from a bog through direct and indirect effects. 833 Scientific Reports, 8(1), 3838. https://doi.org/10.1038/s41598-018- 834 22210-2 835 Kiheri, H., Velmala, S., Pennanen, T., Timonen, S., Sietiö, O.-M., Fritze, H., 836 Heinonsalo, J., van Dijk, N., Dise N., & Larmola, T. (2020). Fungal 837 colonization patterns and enzymatic activities of peatland ericaceous 838 plants following long-term nutrient addition. Soil Biology and 839 Biochemistry, 147, 107833. 840 https://doi.org/10.1016/j.soilbio.2020.107833 841 Kostka, J. E., Weston, D. J., Glass, J. B., Lilleskov, E. A., Shaw, A. J., & Page 30 of 51Global Change Biology https://doi.org/10.1046/j.1365-2486.2002.00535.x https://doi.org/10.1007/s00572-021-01060-3 https://doi.org/10.1111/j.1574-6941.2012.01437.x https://doi.org/10.1007/s10021-010-9361-2 https://doi.org/10.1007/s10021-010-9361-2 https://doi.org/10.1038/s41598-018-22210-2 https://doi.org/10.1038/s41598-018-22210-2 https://doi.org/10.1016/j.soilbio.2020.107833 31 842 Turetsky, M. R. (2016). The Sphagnum microbiome: new insights from 843 an ancient plant lineage. New Phytologist, 211(1), 57-64. 844 https://doi.org/10.1111/nph.13993 845 Kuznetsova, A., Brockhoff, P. B., & Christensen, R. H. B. (2017). lmerTest 846 Package: Tests in linear mixed effects models. Journal of Statistical 847 Software, 82(13), 1-26. https://doi.org/10.18637/jss.v082.i13 848 Lai, J., Zou, Y., Zhang, J., & Peres-Neto, P. R. (2022). Generalizing 849 hierarchical and variation partitioning in multiple regression and 850 canonical analyses using the rdacca.hp R package. Methods in 851 Ecology and Evolution, 13(4), 782-788. https://doi.org/10.1111/2041- 852 210X.13800 853 Lamit, L. J., Romanowicz, K. J., Potvin, L. R., Lennon, J. T., Tringe, S. G., 854 Chimner, R. A., Kolka, R. K., Kane, E. S., & Lilleskov, E. A. (2021). 855 Peatland microbial community responses to plant functional group and 856 drought are depth-dependent. Molecular Ecology, 30(20), 5119-5136. 857 https://doi.org/10.1111/mec.16125 858 Lamit, L. J., Romanowicz, K. J., Potvin, L. R., Rivers, A. R., Singh, K., 859 Lennon, J. T., Tringe, S. G., Kane, E. S., & Lilleskov, E. A. (2017). 860 Patterns and drivers of fungal community depth stratification in 861 Sphagnum peat. FEMS Microbiology Ecology, 93(7), fix082. 862 https://doi.org/10.1093/femsec/fix082 863 Larmola, T., Bubier, J. L., Kobyljanec, C., Basiliko, N., Juutinen, S., 864 Humphreys, E., Preston, M., & Moore, T. R. (2013). Vegetation 865 feedbacks of nutrient addition lead to a weaker carbon sink in an 866 ombrotrophic bog. Global Change Biology, 19(12), 3729-3739. 867 https://doi.org/10.1111/gcb.12328 868 Lems, K. (1956). Ecological study of the peat bogs of Eastern North America: 869 III. Notes ofn the behavior of Chamaedaphne calyculata. Canadian 870 Journal of Botany, 34(1), 197-207. https://doi.org/10.1139/b56-018 Page 31 of 51 Global Change Biology https://doi.org/10.1111/nph.13993 https://doi.org/10.18637/jss.v082.i13 https://doi.org/10.1111/2041-210X.13800 https://doi.org/10.1111/2041-210X.13800 https://doi.org/10.1111/mec.16125 https://doi.org/10.1093/femsec/fix082 https://doi.org/10.1111/gcb.12328 https://doi.org/10.1139/b56-018 32 871 Lenth, R. (2021). emmeans: Estimated marginal means, aka least-squares 872 means. R package version 1.7.0. https://CRAN.R- 873 project.org/package=emmeans 874 Li, T., Bu, Z., Liu, W., Zhang, M., Peng, C., Zhu, Q., Shi, S., Wang, M. (2019). 875 Weakening of the ‘enzymatic latch’ mechanism following long-term 876 fertilization in a minerotrophic peatland. Soil Biology and Biochemistry, 877 136, 107528. https://doi.org/10.1016/j.soilbio.2019.107528 878 Li, T., Peng, C., Bu, Z., Zhu, Q., Song, H., Guo, X., & Wang, M. (2021). 879 Woody plants reduce the sensitivity of soil extracellular enzyme activity 880 to nutrient enrichment in wetlands: A meta-analysis. Soil Biology and 881 Biochemistry, 159, 108280. 882 https://doi.org/10.1016/j.soilbio.2021.108280 883 Lilleskov, E. A., Fahey, T. J., Horton, T. R., & Lovett, G. M. (2002). 884 Belowground ectomycorrhizal fungal community change over a 885 nitrogen deposition gradient in Alaska. Ecology, 83(1), 104-115. 886 https://doi.org/10.1890/0012-9658(2002)083[0104:BEFCCO]2.0.CO;2 887 Lilleskov, E. A., Fahey, T. J., & Lovett, G. M. (2001). Ectomycorrhizal fungal 888 aboveground community change over an atmospheric nitrogen 889 deposition gradient. Ecological Applications, 11(2), 397-410. 890 https://doi.org/10.1890/1051-0761(2001)011[0397:EFACCO]2.0.CO;2 891 Lilleskov, E. A., Hobbie, E. A., & Horton, T. R. (2011). Conservation of 892 ectomycorrhizal fungi: exploring the linkages between functional and 893 taxonomic responses to anthropogenic N deposition. Fungal Ecology, 894 4(2), 174-183. https://doi.org/10.1016/j.funeco.2010.09.008 895 Lilleskov, E. A., Kuyper, T. W., Bidartondo, M. I., & Hobbie, E. A. (2024). 896 Chapter 6 - Impacts of nitrogen deposition on forest mycorrhizal 897 communities. In E. Du & W. de Vries (Eds.), Atmospheric Nitrogen 898 Deposition to Global Forests (pp. 95-118). Academic Press. 899 Limpens, J., Granath, G., Gunnarsson, U., Aerts, R., Bayley, S., Bragazza, L., Page 32 of 51Global Change Biology https://CRAN.R-project.org/package=emmeans https://CRAN.R-project.org/package=emmeans https://doi.org/10.1016/j.soilbio.2019.107528 https://doi.org/10.1016/j.soilbio.2021.108280 https://doi.org/10.1890/0012-9658(2002)083%5b0104:BEFCCO%5d2.0.CO;2 https://doi.org/10.1890/1051-0761(2001)011%5b0397:EFACCO%5d2.0.CO;2 https://doi.org/10.1016/j.funeco.2010.09.008 33 900 Bubier, J., Buttler, A., van den Berg, L. J. L., Francez, A. J., Gerdol, R., 901 Grosvernier, P., Heijmans, M. M. P. D., Hoosbeek, M. R., Hotes, S., 902 Ilomets, M., Leith, I., Mitchell, E. A. D., Moore, T., … Xu, B. (2011). 903 Climatic modifiers of the response to nitrogen deposition in peat- 904 forming Sphagnum mosses: a meta-analysis. New Phytologist, 191(2), 905 496-507. https://doi.org/10.1111/j.1469-8137.2011.03680.x 906 Lin, X., Tfaily, M. M., Green, S. J., Steinweg, J. M., Chanton, P., Imvittaya, A., 907 Chanton, J. P., Cooper, W., Schadt, C., & Kostka, J. E. (2014a). 908 Microbial metabolic potential for carbon degradation and nutrient 909 (nitrogen and phosphorus) acquisition in an ombrotrophic peatland. 910 Applied and Environmental Microbiology, 80(11), 3531-3540. 911 https://doi.org/10.1128/aem.00206-14 912 Lin, X., Tfaily, M. M., Steinweg, J. M., Chanton, P., Esson, K., Yang, Z. K., 913 Chanton, J. P., Cooper, W., Schadt, C., & Kostka, J. E. (2014b). 914 Microbial community stratification linked to utilization of carbohydrates 915 and phosphorus limitation in a boreal peatland at Marcell Experimental 916 Forest, Minnesota, USA. Applied and Environmental Microbiology, 917 80(11), 3518-3530. https://doi.org/10.1128/aem.00205-14 918 Lindahl, B. D., & Tunlid, A. (2015). Ectomycorrhizal fungi–potential organic 919 matter decomposers, yet not saprotrophs. New Phytologist, 205(4), 920 1443-1447. https://doi.org/10.1111/nph.13201 921 Liu, Y., Shi, G., Mao, L., Cheng, G., Jiang, S., Ma, X., An, L., Du, G., Johnson, 922 N. C., & Feng, H. (2012). Direct and indirect influences of 8 yr of 923 nitrogen and phosphorus fertilization on Glomeromycota in an alpine 924 meadow ecosystem. New Phytologist, 194(2), 523-535. 925 https://doi.org/10.1111/j.1469-8137.2012.04050.x 926 Loisel, J., Yu, Z., Beilman, D. W., Camill, P., Alm, J., Amesbury, M. J., 927 Anderson, D., Andersson, S., Bochicchio, C., Barber, K., Belyea, L. R., 928 Bunbury, J., Chambers, F. M., Charman, D. J., De Vleeschouwer, F., Page 33 of 51 Global Change Biology https://doi.org/10.1111/j.1469-8137.2011.03680.x https://doi.org/10.1128/aem.00206-14 https://doi.org/10.1128/aem.00205-14 https://doi.org/10.1111/nph.13201 https://doi.org/10.1111/j.1469-8137.2012.04050.x 34 929 Fiałkiewicz-Kozieł, B., Finkelstein, S. A., Gałka, M., Garneau, M., … 930 Zhou, W. (2014). A database and synthesis of northern peatland soil 931 properties and Holocene carbon and nitrogen accumulation. Holocene, 932 24(9), 1028-1042. https://doi.org/10.1177/0959683614538073 933 MacDonald, A. J., Kirkpatrick, A. H., Hester, A. J., & Sydes, C. (1995). 934 Regeneration by natural layering of heather (Calluna vulgaris): 935 Frequency and characteristics in upland Britain. Journal of Applied 936 Ecology, 32(1), 85-99. https://doi.org/10.2307/2404418 937 Martino, E., Morin, E., Grelet, G.-A., Kuo, A., Kohler, A., Daghino, S., Barry, K. 938 W., Cichocki, N., Clum, A., Dockter, R. B., Hainaut, M., Kuo, R. C., 939 LaButti, K., Lindahl, B. D., Lindquist, E. A., Lipzen, A., Khouja, H.-R., 940 Magnuson, J., Murat, C., ... Perotto, S. (2018). Comparative genomics 941 and transcriptomics depict ericoid mycorrhizal fungi as versatile 942 saprotrophs and plant mutualists. New Phytologist, 217(3), 1213-1229. 943 https://doi.org/10.1111/nph.14974 944 Mitchell, E. A. D., Buttler, A., Grosvernier, P., Rydin, H., Siegenthaler, A., & 945 Gobat, J. M. (2002). Contrasted effects of increased N and CO2 supply 946 on two keystone species in peatland restoration and implications for 947 global change. Journal of Ecology, 90(3), 529-533. 948 https://doi.org/10.1046/j.1365-2745.2002.00679.x 949 Moore, T. R., Knorr, K.-H., Thompson, L., Roy, C., & Bubier, J. L. (2019). The 950 effect of long-term fertilization on peat in an ombrotrophic bog. 951 Geoderma, 343, 176-186. 952 https://doi.org/10.1016/j.geoderma.2019.02.034 953 Muff, S., Nilsen, E. B., O’Hara, R. B., & Nater, C. R. (2022). Rewriting results 954 sections in the language of evidence. Trends in Ecology & Evolution, 955 37(3), 203-210. https://doi.org/10.1016/j.tree.2021.10.009 956 Murphy, M. T. (2009). Getting to the root of the matter: variations in vascular 957 root biomass and production in peatlands and responses to global Page 34 of 51Global Change Biology https://doi.org/10.1177/0959683614538073 https://doi.org/10.2307/2404418 https://doi.org/10.1111/nph.14974 https://doi.org/10.1046/j.1365-2745.2002.00679.x https://doi.org/10.1016/j.geoderma.2019.02.034 https://doi.org/10.1016/j.tree.2021.10.009 35 958 change. (Ph.D.). McGill University, Montreal, Canada. 959 Netherway, T., Bengtsson, J., Buegger, F., Fritscher, J., Oja, J., Pritsch, K., 960 Hildebrand, F., Krab, E. J., & Bahram, M. (2024). Pervasive 961 associations between dark septate endophytic fungi with tree root and 962 soil microbiomes across Europe. Nature Communications, 15(1), 159. 963 https://doi.org/10.1038/s41467-023-44172-4 964 Nilsson, R. H., Tedersoo, L., Ryberg, M., Kristiansson, E., Hartmann, M., 965 Unterseher, M., Porter, T. M., Bengtsson-Palme, J., Walker, D. M., De 966 Sousa, F., Gamper, H. A., Larsson, E., Larsson, K.-H., Kõljalg, U., 967 Edgar, R. C., & Abarenkov, K. (2015). A comprehensive, automatically 968 updated fungal its sequence dataset for reference-based chimera 969 control in environmental sequencing efforts. Microbes and 970 Environments, 30(2), 145-150. https://doi.org/10.1264/jsme2.me14121 971 Peñuelas, J., Poulter, B., Sardans, J., Ciais, P., van der Velde, M., Bopp, L., 972 Boucher, O., Godderis, Y., Hinsinger, P., Llusia, J., Nardin, E., Vicca, 973 S., Obersteiner, M., & Janssens, I. A. (2013). Human-induced nitrogen- 974 phosphorus imbalances alter natural and managed ecosystems across 975 the globe. Nature Communications, 4, 2934. 976 https://doi.org/10.1038/Ncomms3934 977 Pipes, G. T., & Yavitt, J. B. (2022). Biochemical components of Sphagnum 978 and persistence in peat soil. Canadian Journal of Soil Science, 102(3), 979 785-795. https://doi.org/10.1139/cjss-2021-0137 980 Põlme, S., Abarenkov, K., Henrik Nilsson, R., Lindahl, B. D., Clemmensen, K. 981 E., Kauserud, H., Nguyen, N., Kjøller, R., Bates, S. T., Baldrian, P., 982 Frøslev, T. G., Adojaan, K., Vizzini, A., Suija, A., Pfister, D., Baral, H.- 983 O., Järv, H., Madrid, H., Nordén, J., ... Tedersoo, L. (2020). 984 FungalTraits: a user-friendly traits database of fungi and fungus-like 985 stramenopiles. Fungal Diversity, 105(1), 1-16. 986 https://doi.org/10.1007/s13225-020-00466-2 Page 35 of 51 Global Change Biology https://doi.org/10.1038/s41467-023-44172-4 https://doi.org/10.1264/jsme2.me14121 https://doi.org/10.1038/Ncomms3934 https://doi.org/10.1139/cjss-2021-0137 https://doi.org/10.1007/s13225-020-00466-2 36 987 Poznanovic, S. K., Lilleskov, E. A., & Webster, C. R. (2015). Sharing rotting 988 wood in the shade: ectomycorrhizal communities of co-occurring birch 989 and hemlock seedlings. Mycorrhiza, 25(2), 153-164. 990 https://doi.org/10.1007/s00572-014-0597-0 991 Prescott, C. E., Grayston, S. J., Helmisaari, H.-S., Kaštovská, E., Körner, C., 992 Lambers, H., Meier, I. C., Millard, P., & Ostonen, I. (2020). Surplus 993 carbon drives allocation and plant–soil interactions. Trends in Ecology 994 & Evolution, 35(12), 1110-1118. 995 https://doi.org/10.1016/j.tree.2020.08.007 996 Putz, F. E., Canham, C. D., & Ollinger, S. V. (2024). Belowground exploration 997 by trees and shrubs. Plant Ecology, 225(6), 605-610. 998 https://doi.org/10.1007/s11258-024-01416-7 999 R Core Team. (2021). R: A language and environment for statistical 1000 computing. R foundation for Statistical Computing. 1001 Rydin, H., & Jeglum, J. K. (2013). The biology of peatlands (2nd ed.). Oxford 1002 University Press. 1003 Schillereff, D. N., Chiverrell, R. C., Sjöström, J. K., Kylander, M. E., Boyle, J. 1004 F., Davies, J. A. C., Toberman, H., & Tipping, E. (2021). Phosphorus 1005 supply affects long-term carbon accumulation in mid-latitude 1006 ombrotrophic peatlands. Communications Earth & Environment, 2(1), 1007 241. https://doi.org/10.1038/s43247-021-00316-2 1008 Sheppard, L. J., Leith, I. D., Mizunuma, T., Leeson, S., Kivimaki, S., Neil 1009 Cape, J., van Dijk, N., Leaver, D., Sutton, M. A., Fowler, D., Van den 1010 Berg, L. J., Crossley, A., Field, C., & Smart, S. (2014). Inertia in an 1011 ombrotrophic bog ecosystem in response to 9 years' realistic 1012 perturbation by wet deposition of nitrogen, separated by form. Global 1013 Change Biology, 20(2), 566-580. https://doi.org/10.1111/gcb.12357 1014 Treseder, K. K., Berlemont, R., Allison, S. D., & Martiny, A. C. (2018). 1015 Nitrogen enrichment shifts functional genes related to nitrogen and Page 36 of 51Global Change Biology https://doi.org/10.1007/s00572-014-0597-0 https://doi.org/10.1016/j.tree.2020.08.007 https://doi.org/10.1007/s11258-024-01416-7 https://doi.org/10.1038/s43247-021-00316-2 https://doi.org/10.1111/gcb.12357 37 1016 carbon acquisition in the fungal community. Soil Biology and 1017 Biochemistry, 123, 87-96. https://doi.org/10.1016/j.soilbio.2018.05.014 1018 van Breemen, N. (1995). How Sphagnum bogs down other plants. Trends in 1019 Ecology & Evolution, 10(7), 270-275. https://doi.org/10.1016/0169- 1020 5347(95)90007-1 1021 Verbeke, B. A., Lamit, L. J., Lilleskov, E. A., Hodgkins, S. B., Basiliko, N., 1022 Kane, E. S., Andersen, R., Artz, R. R. E., Benavides, J. C., Benscoter, 1023 B. W., Borken, W., Bragazza, L., Brandt, S. M., Bräuer, S. L., Carson, 1024 M. A., Charman, D., Chen, X., Clarkson, B. R., Cobb, A. R., ... 1025 Chanton, J. P. (2022). Latitude, elevation, and mean annual 1026 temperature predict peat organic matter chemistry at a global scale. 1027 Global Biogeochemical Cycles, 36(2), e2021GB007057. 1028 https://doi.org/10.1029/2021GB007057 1029 Vesala, R., Kiheri, H., Hobbie, E. A., van Dijk, N., Dise, N., & Larmola, T. 1030 (2021). Atmospheric nitrogen enrichment changes nutrient 1031 stoichiometry and reduces fungal N supply to peatland ericoid 1032 mycorrhizal shrubs. Science of the Total Environment, 794, 148737. 1033 https://doi.org/10.1016/j.scitotenv.2021.148737 1034 Von Post, L. (1922). Sveriges geologiska undersöknings torvinventering och 1035 några av dess hittills vunna resultat. Svenska Mosskulturföreningens 1036 Tidskrift, 1, 1-27. 1037 Wang, H., Richardson, C. J., & Ho, M. (2015). Dual controls on carbon loss 1038 during drought in peatlands. Nature Climate Change, 5(6), 584-587. 1039 https://doi.org/10.1038/nclimate2643 1040 Wang, M., Lamit, L. J., Lilleskov, E. A., Basiliko, N., Moore, T. R., Bubier, J. L, 1041 Guo, G., Juutinen, S., & Larmola, T. (2024). Peatland fungal 1042 community responses to nutrient enrichment: a story beyond nitrogen. 1043 Dryad. Version 2. https://doi.org/10.5061/dryad.kh18932hd 1044 Wang, M., Larmola, T., Murphy, M. T., Moore, T. R., & Bubier, J. L. (2016). Page 37 of 51 Global Change Biology https://doi.org/10.1016/j.soilbio.2018.05.014 https://doi.org/10.1016/0169-5347(95)90007-1 https://doi.org/10.1016/0169-5347(95)90007-1 https://doi.org/10.1029/2021GB007057 https://doi.org/10.1016/j.scitotenv.2021.148737 https://doi.org/10.1038/nclimate2643 https://doi.org/10.5061/dryad.kh18932hd 38 1045 Stoichiometric response of shrubs and mosses to long-term nutrient (N, 1046 P and K) addition in an ombrotrophic peatland. Plant and Soil, 400(1), 1047 403-416. https://doi.org/10.1007/s11104-015-2744-6 1048 Wang, M., Tian, J., Bu, Z., Lamit, L. J., Chen, H., Zhu, Q., & Peng, C. (2019). 1049 Structural and functional differentiation of the microbial community in 1050 the surface and subsurface peat of two minerotrophic fens in China. 1051 Plant and Soil, 437(1-2), 21-40. https://doi.org/10.1007/s11104-019- 1052 03962-w 1053 Wang, R., Goll, D., Balkanski, Y., Hauglustaine, D., Boucher, O., Ciais, P., 1054 Janssens, I., Penuelas, J., Guenet, B., Sardans, J., Bopp, L., Vuichard, 1055 N., Zhou, F., Li, B., Piao, S., Peng, S., Huang, Y., & Tao, S. (2017). 1056 Global forest carbon uptake due to nitrogen and phosphorus deposition 1057 from 1850 to 2100. Global Change Biology, 23(11), 4854-4872. 1058 https://doi.org/10.1111/gcb.13766 1059 Watmough, S., Gilbert-Parkes, S., Basiliko, N., Lamit, L. J., Lilleskov, E. A., 1060 Andersen, R., del Aguila-Pasquel, J., Artz, R. E., Benscoter, B. W., 1061 Borken, W., Bragazza, L., Brandt, S. M., Bräuer, S. L., Carson, M. A., 1062 Chen, X., Chimner, R. A., Clarkson, B. R., Cobb, A. R., Enriquez, A. 1063 S., ... Zahn, G. (2022). Variation in carbon and nitrogen concentrations 1064 among peatland categories at the global scale. PLoS One, 17(11), 1065 e0275149. https://doi.org/10.1371/journal.pone.0275149 1066 White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct 1067 sequencing of fungal ribosomal RNA genes for phylogenetics. In M. 1068 Innis, D. Gelfand, J. Sninsky & T. White (Eds.), PCR protocols: a guide 1069 to methods and applications (pp. 315-322). Academic Press. 1070 Wiedermann, M. M., Kane, E. S., Potvin, L. R., & Lilleskov, E. A. (2017). 1071 Interactive plant functional group and water table effects on 1072 decomposition and extracellular enzyme activity in Sphagnum 1073 peatlands. Soil Biology and Biochemistry, 108, 1-8. Page 38 of 51Global Change Biology https://doi.org/10.1007/s11104-015-2744-6 https://doi.org/10.1007/s11104-019-03962-w https://doi.org/10.1007/s11104-019-03962-w https://doi.org/10.1111/gcb.13766 https://doi.org/10.1371/journal.pone.0275149 39 1074 https://doi.org/10.1016/j.soilbio.2017.01.008 1075 Yin, T., Feng, M., Qiu, C., & Peng, S. (2022). Biological nitrogen fixation and 1076 nitrogen accumulation in peatlands. Frontiers in Earth Science, 10, 1077 670867. https://doi.org/10.3389/feart.2022.670867 1078 Zak, D. R., Argiroff, W. A., Freedman, Z. B., Upchurch, R. A., Entwistle, E. M., 1079 & Romanowicz, K. J. (2019). Anthropogenic N deposition, fungal gene 1080 expression, and an increasing soil carbon sink in the Northern 1081 Hemisphere. Ecology, 100(10), e02804. 1082 https://doi.org/10.1002/ecy.2804 1083 Živković, T., Helbig, M., & Moore, T. R. (2022). Seasonal and spatial 1084 variability of biological N2 fixation in a cool temperate bog. Journal of 1085 Geophysical Research: Biogeosciences, 127(2), e2021JG006481. 1086 https://doi.org/10.1029/2021JG006481 1087 Page 39 of 51 Global Change Biology https://doi.org/10.1016/j.soilbio.2017.01.008 https://doi.org/10.3389/feart.2022.670867 https://doi.org/10.1002/ecy.2804 https://doi.org/10.1029/2021JG006481 40 1088 Table 1 Fertilization experiment set-up. Addition rate Cumulative addition to time of sampling in 2014 N P K N P K Treatment Start year (g m-2 yr-1) (g m-2) Experiment 1 C1 2000 0 0 0 0 0 0 PK 2000 0 5 6.3 0 75 95 1.6N 2000 1.6 0 0 24 0 0 1.6N+PK 2000 1.6 5 6.3 24 75 95 3.2N+PK 2001 3.2 5 6.3 44.8 70 88 6.4N+PK 2001 6.4 5 6.3 89.6 70 88 Experiment 2 C2 2005 0 0 0 0 0 0 3.2N 2005 3.2 0 0 32 0 0 6.4N 2005 6.4 0 0 64 0 0 1089 Page 40 of 51Global Change Biology 41 1090 Table 2 PERMANOVA results of fungal community composition under different fertilization treatments and sampling depths. Analysis* Treatment (df F p) Depth (df F p) Treatment × Depth (df F p) Core (df F p) Experiment 1 PERMANOVA mixed model 5, 12.57# 2.2 0.001 2, 18 5.72 0.001 10, 18 1.03 0.38 12, 18 2.03 0.001 PERMDISP 5, 42 0.31 0.95 2, 45 3.36 0.052 17, 30 9.83 0.21 17, 30 2.65 0.65 Experiment 2 PERMANOVA mixed model 2, 6.13 1.26 0.032 2, 10 4.46 0.0002 4, 10 1.06 0.37 6, 10 3.05 0.0001 PERMDISP 2, 22 0.11 0.91 2, 22 2.42 0.14 8, 16 4.07 0.14 8, 16 2.59 0.45 All PERMANOVA mixed model 8, 18.6 2.05 0.0001 2, 28 8.24 0.0001 16, 28 1.12 0.077 18, 28 2.3 0.0001 PERMDISP 8, 64 0.84 0.75 2, 70 5.12 0.013 26, 46 10.95 0.083 26, 46 2.85 0.57 1091 * PERMANOVA mixed models include treatment, depth and treatment × depth as fixed factors, and individual core as a random factor. PERMDISP is run to 1092 examine the differences in dispersion among treatments, depths, or all unique treatment × depth combination. Results with moderate (p < 0.05) to very 1093 strong evidence (p < 0.001) of difference among treatments and depth are highlighted in bold. 1094 # The degrees of freedom for the nominator and denominator, respectively. 1095 Page 41 of 51 Global Change Biology 42 1096 Table 3 Alpha diversity indices (mean ± SE) under different fertilization 1097 treatments and sampling depths. Treatments/Depths OTU richness Shannon’s diversity index Pielou’s evenness index Experiment 1 C1 178 ± 26 A 3.3 ± 0.3 AB 0.65 ± 0.04 A PK 172 ± 23 A 2.7 ± 0.2 A 0.54 ± 0.05 AB 1.6N 238 ± 37 AB 3.6 ± 0.2 ABC 0.67 ± 0.04 ABC 1.6N+PK 324 ± 57 C 4.5 ± 0.3 C 0.78 ± 0.04 BC 3.2N+PK 294 ± 46 BC 4.5 ± 0.3 BC 0.82 ± 0.06 BC 6.4N+PK 274 ± 42 ABC 4.7 ± 0.2 C 0.86 ± 0.03 C 10-20 cm 295 ± 26 b 3.7 ± 0.3 0.66 ± 0.04 30-40 cm 284 ± 32 b 3.9 ± 0.2 0.71 ± 0.03 60-70 cm 151 ± 12 a 3.9 ± 0.3 0.78 ± 0.05 Experiment 2 C2 163 ± 23 3.5 ± 0.3 0.69 ± 0.05 3.2N 147 ± 16 3.6 ± 0.2 0.72 ± 0.04 6.4N 212 ± 34 3.8 ± 0.3 0.73 ± 0.05 10-20 cm 227 ± 30 b 3.7 ± 0.2 0.69 ± 0.03 ab 30-40 cm 156 ± 22 a 3.3 ± 0.3 0.65 ± 0.05 a 60-70 cm 134 ± 11 a 4.0 ± 0.2 0.73 ± 0.05 b 1098 There is no evidence for an interactive effect between treatment and depth, 1099 therefore only the main effects are shown. Different upper-case letters 1100 indicate that there is evidence that the indices are different among treatments 1101 with all depths pooled. Different lower-case letters indicate that there is 1102 evidence (p < 0.05) that the indices are different among depths with all 1103 treatments pooled. Values that do not have letters indicate there is no 1104 evidence (p > 0.1) that the alpha diversity index is different among treatments 1105 or depths. Two sets of experiments are analyzed separately. 1106 Page 42 of 51Global Change Biology 43 1107 Table 4 Relative abundance (%) of putative nitrophobic and nitrophilic ectomycorrhizal fungi in response to the additions of N and/or PK. Treatment Cenococcum Cortinarius Laccaria Paxillus Pseudotomentella Suillus Tomentella C1 0 0.123 BC 0 0 0 0 0 PK 0 0.002 A 0 0 0 0 0 1.6N 0 0.209 C 0 0 0 0.008 0 1.6NPK 0.001 0.007 A 0 0 0 0 0 3.2NPK 0.006 0.015 A 0 0 0.713 0.019 0 6.4NPK 0.016 0.005 A 0.017 0.010 0 0 0.092 C2 0 0 0 0 0 0 0 3.2N 0 0 0.004 0 0 0 0 6.4N 0.024 0.024 0.001 0 0 0 0 Response +N ↑ ↑ ↑ - - ↑ - +PK - ↓ - - - - - +NPK ↑ ↓ ↑ ↑ ↑ ↑ ↑ Strategy* nitrophobic nitrophobic nitrophilic nitrophilic nitrophobic nitrophobic mixed 1108 Symbols indicate the positive (↑), negative (↓) or neutral (-) effects of N, PK or NPK additions on the relative abundance of putative nitrophobic and 1109 nitrophilic ectomycorrhizal fungal species. Please note that the direction of response is based on the summary of trends instead of statistical analysis expect 1110 for Cortinarius, considering the limitation of small sample size. Different upper-case letters indicate that there is evidence that the relative abundance of 1111 Cortinarius is different among treatments with all depths pooled. *Different strategies are adopted from Lilleskov et al. (2001, 2002 and 2011). 1112 Page 43 of 51 Global Change Biology 44 1113 Figure captions 1114 1115 Figure1 Relative abundance of dominant fungal orders for different 1116 treatments (a) and depths (b, Experiment 1; c, Experiment 2). Stacked bars 1117 are ordered by decreasing the number of total sequences per order (bottom to 1118 top) with all samples pooled. Abbreviations of treatments as described in 1119 Table 1. 1120 1121 Figure 2 Canonical analysis of principal coordinates (CAP) with fungal 1122 community composition among different treatments (a, with all depths pooled) 1123 and depths (b, with all treatments pooled). Samples of all treatments from the 1124 two experiments are pooled to visualize the pattern of vertical stratification. 1125 Abbreviations of treatments as described in Table 1. 1126 1127 Figure 3 Relative abundance of dominant fungal genera for different 1128 treatments (a) and depths (b, Experiment 1; c, Experiment 2). Stacked bars 1129 are ordered by decreasing the number of total sequences per genera (bottom 1130 to top) with all samples pooled. Abbreviations of treatments as describes in 1131 Table 1. 1132 1133 Figure 4 Relative abundance (mean ± SE) of ericoid mycorrhizal fungi, 1134 ectomycorrhizal fungi and Sphagnum-associated fungi under different 1135 treatments (a, d, g) and depths (b, c, e, f, h, i). There is very strong evidence 1136 (p < 0.001) for the interactive effects for ericoid mycorrhizal fungi in 1137 Experiment 1 (b) and ectomycorrhizal fungi in Experiment 2 (f), and only the 1138 main effects are shown for Sphagnum-associated fungi (Supplementary Table 1139 S5). Different upper-case letters indicate there is evidence (p < 0.05) that the 1140 relative abundance of fungal functional guild is different among treatments Page 44 of 51Global Change Biology 45 1141 under the same depth. Different lower-case letters indicate there is evidence 1142 (p < 0.05) that the relative abundance of fungal functional guild is different 1143 among depths under the same treatment. Bars without letters indicate there is 1144 no evidence (p > 0.1) that the relative abundance of fungal functional guild is 1145 different among treatments or depths. Abbreviations of treatments as 1146 described in Table 1. 1147 1148 Figure 5 Relative abundance (mean ± SE) of lignocellulose-degrading fungi 1149 and saprotrophic fungi (includes only non-lignocellulose degrading 1150 saprotrophic fungi) under different treatments (a, d) and depths (b, c, 1151 Experiment 1; e, f, Experiment 2). Different upper-case letters indicate there is 1152 evidence (p < 0.05) that the relative abundance of saprotrophic fungi is 1153 different among treatments under the same depth. Bars without letters 1154 indicate there is no evidence (p > 0.1) that the relative abundance of fungal 1155 functional guild is different among treatments or depths. Abbreviations of 1156 treatments as described in Table 1. 1157 1158 Figure 6 Abundance (mean ± SE) of Ericaceae (a) and covers of Sphagnum 1159 (b) and Polytrichum (c) mosses in response to different treatments. Different 1160 upper-case letters indicate there is evidence (p < 0.05) that the relative 1161 abundance of fungal functional guild is different among treatments for each 1162 experiment separately. For Ericaceae, there is no evidence (p > 0.1) that 1163 treatments affect the abundance of Ericaceae in Experiment 1. Bars without 1164 letters indicate there is no evidence (p > 0.1) that the abundance of Ericaceae 1165 is different among treatments. Abbreviations of treatments as described in 1166 Table 1. Page 45 of 51 Global Change Biology Figure1 Relative abundance of dominant fungal orders for different treatments (a) and depths (b, Experiment 1; c, Experiment 2). Stacked bars are ordered by decreasing the number of total sequences per order (bottom to top) with all samples pooled. Abbreviations of treatments as described in Table 1. 363x214mm (300 x 300 DPI) Page 46 of 51Global Change Biology Figure 2 Canonical analysis of principal coordinates (CAP) with fungal community composition among different treatments (a, with all depths pooled) and depths (b, with all treatments pooled). Samples of all treatments from the two experiments are pooled to visualize the pattern of vertical stratification. Abbreviations of treatments as described in Table 1. 271x98mm (300 x 300 DPI) Page 47 of 51 Global Change Biology Figure 3 Relative abundance of dominant fungal genera for different treatments (a) and depths (b, Experiment 1; c, Experiment 2). Stacked bars are ordered by decreasing the number of total sequences per genera (bottom to top) with all samples pooled. Abbreviations of treatments as describes in Table 1. 389x214mm (300 x 300 DPI) Page 48 of 51Global Change Biology Figure 4 Relative abundance (mean ± SE) of ericoid mycorrhizal fungi, ectomycorrhizal fungi and Sphagnum-associated fungi under different treatments (a, d, g) and depths (b, c, e, f, h, i). There is very strong evidence (p < 0.001) for the interactive effects for ericoid mycorrhizal fungi in Experiment 1 (b) and ectomycorrhizal fungi in Experiment 2 (f), and only the main effects are shown for Sphagnum-associated fungi (Supplementary Table S5). Different upper-case letters indicate there is evidence (p < 0.05) that the relative abundance of fungal functional guild is different among treatments under the same depth. Different lower-case letters indicate there is evidence (p < 0.05) that the relative abundance of fungal functional guild is different among depths under the same treatment. Bars without letters indicate there is no evidence (p > 0.1) that the relative abundance of fungal functional guild is different among treatments or depths. Abbreviations of treatments as described in Table 1. 292x680mm (300 x 300 DPI) Page 49 of 51 Global Change Biology Figure 5 Relative abundance (mean ± SE) of lignocellulose-degrading fungi and saprotrophic fungi (includes only non-lignocellulose degrading saprotrophic fungi) under different treatments (a, d) and depths (b, c, Experiment 1; e, f, Experiment 2). Different upper-case letters indicate there is evidence (p < 0.05) that the relative abundance of saprotrophic fungi is different among treatments under the same depth. Bars without letters indicate there is no evidence (p > 0.1) that the relative abundance of fungal functional guild is different among treatments or depths. Abbreviations of treatments as described in Table 1. 361x438mm (300 x 300 DPI) Page 50 of 51Global Change Biology Figure 6 Abundance (mean ± SE) of Ericaceae (a) and covers of Sphagnum (b) and Polytrichum (c) mosses in response to different treatments. Different upper-case letters indicate there is evidence (p < 0.05) that the relative abundance of fungal functional guild is different among treatments for each experiment separately. For Ericaceae, there is no evidence (p > 0.1) that treatments affect the abundance of Ericaceae in Experiment 1. Bars without letters indicate there is no evidence (p > 0.1) that the abundance of Ericaceae is different among treatments. Abbreviations of treatments as described in Table 1. 186x582mm (300 x 300 DPI) Page 51 of 51 Global Change Biology Kansilehti_Wang_2024_Glob_Change_Biol_Peatland_fungal_community GCB-24-2353.R1_Proof_fl.pdf